SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00832
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.543 Nuclear   Reliability : 2.163
 

Sequence

CDS
ATGCCTCCTCTCGTACGCCCTTCAGGCCAACCACCGGCTTTCGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAATACGCGGACCCCGAACACACCGAGGCAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCACCCTCGGACGCGTTACCCCCCATTACCTCTGACGAAGTTAGAGAAGTAATAGACAACCTTCAACCTAAGAAGGCACCCGGCTCCGACGGCATCCGCAACCGCGCGTTAAAACTCTTACCAGTCCAACTGATAACAATGTTGGCTACCATCTTAAATGCTGCTATGACGCACTGCATCTTTCCGGCGGTATGGAAAGAAGCAGACGTTATCGGTATACACAAGCCGGGCAAACCGAATAATGAAACCGCTAGTTACCGACCGATTAGTCTCCTCCCAGCGATAGGCAAAATTTACGAACGGCTCCTTCGGAAACGCCTCTGGGACTTCGTTACCGCGAATAAAATTCTAATAGACGAGCAGTTTGGATTCCGCGCCAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATCTTAATAGGGCTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGATGTAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATCTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCATCTGACTGCCGGAGTCCCGCAAGGCTCCGCACTCTCCCCGTTACTATTTAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCCATCTACTACTCGTGTAGGAAGATGTCGTTGCTTCATCGGCGACTCCAGACCGCAGTAACCACCATGGGACAGTGGTTCCGGAAGTGGCGAATAGACATTAACCCCACGAAAAGCACAGCGGTGCTATTCAAAAGGGGTCGCCCTCCGAATACCACTTCGAGCACCCCACTCCCCAGTAGGCGCGTAAACACCTCCGCCGTTAGCCCCATCACTCTCTTTGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATACCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCACGTAAAAACGGTACGCGATCGCGCCGCGTTTATACTAGGACGACTCTACCCAATGCTTTGTAGACGAAGCAAACTGTCCCTCCGTAACAAGGTAACCCTCTACAAAACTTGCATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACGCGGCCCGCACTAACTTGAAACCCCTTCAGGTAATACAATCCCGATTCTGCAGGATAGCCGTCGGAGCACCATGGTTCCAGAGGAACGTGGACCTCCACGATGACCTGGAGCTCGACCCCGTCAGTAAGTATCTACAGTCGGCATCGCTGCGCCACTTTGAGAAGGCGGCACGACATGAGAACCCTCTTGTCGTGGCCGCCGGAAACTACATACCCGATCCTGTAGACCGTTTGGTAAACCGTCGACGTCGCCCAAAGCACGTCATCACGGATCCTCCTGATCCACTAACGGTGCTTTTAGGCAATACAAGCACCGGTCACCGTCCTCGCCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGCGAATTAA
Protein
MPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQYADPEHTEAVDREVERRASLPPSDALPPITSDEVREVIDNLQPKKAPGSDGIRNRALKLLPVQLITMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPNNETASYRPISLLPAIGKIYERLLRKRLWDFVTANKILIDEQFGFRAKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDVAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRHLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQTAVTTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTSSTPLPSRRVNTSAVSPITLFDQPIPWAPKVKYLGVTLDRGMTFRPHVKTVRDRAAFILGRLYPMLCRRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKPLQVIQSRFCRIAVGAPWFQRNVDLHDDLELDPVSKYLQSASLRHFEKAARHENPLVVAAGNYIPDPVDRLVNRRRRPKHVITDPPDPLTVLLGNTSTGHRPRRTRRLRRRARRAN

Summary

EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KC165845    AFY12622.1    KQ459265    KPJ02064.1    KQ459259    KPJ02068.1    AF081103    AAC72921.1    AF081101    AAC72919.1    GEZM01008457    JAV94772.1    GALX01005359    JAB63107.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    GGMR01019198    MBY31817.1    GALX01005299    JAB63167.1    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02003961    ABLF02059872    ABLF02042518    ABLF02057746    ABLF02008933    KK117880    KFM71667.1    GFTR01008038    JAW08388.1    GGMR01016114    MBY28733.1    GGMS01000737    MBY69940.1    GBBI01004571    JAC14141.1    GEZM01038405    JAV81653.1    GGMS01004685    MBY73888.1    GGMS01008766    MBY77969.1    GGMR01018716    MBY31335.1    GBBI01001646    JAC17066.1    GGMS01012005    MBY81208.1    RPOV01000134    RPJ78669.1    GBBI01004395    JAC14317.1    GFXV01007093    MBW18898.1    GGMS01002992    MBY72195.1    GGMR01003407    MBY16026.1    NEVH01006736    PNF36716.1    GEZM01053022    JAV74219.1    NEVH01007393    PNF35987.1    NEVH01012089    PNF30491.1    LBMM01010106    KMQ87671.1    GFTR01008251    JAW08175.1    NEVH01007578    PNF35646.1    GGMS01006359    MBY75562.1    JXUM01155316    KQ572171    KXJ68070.1    GGMS01017914    MBY87117.1    GGMR01000676    MBY13295.1    GFXV01006424    MBW18229.1    NWSH01000032    PCG80497.1    S59870    AAB26437.2    NEVH01006721    PNF37225.1    GGFJ01002256    MBW51397.1    GGFJ01002257    MBW51398.1    GBGD01000880    JAC88009.1    GBGD01000799    JAC88090.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01003017    PNF40781.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GFTR01008256    JAW08170.1    NEVH01018383    PNF23463.1    NEVH01007443    PNF35684.1    NEVH01020071    PNF21969.1    NEVH01026386    PNF14434.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01023962    PNF17612.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGFJ01001842    MBW50983.1    GGFJ01001844    MBW50985.1    GGFJ01001843    MBW50984.1    NEVH01010546    PNF32261.1    GGMR01004661    MBY17280.1    KK113014    KFM59099.1    NEVH01005938    PNF38077.1    NEVH01020940    PNF20481.1    GGFJ01001858    MBW50999.1    NEVH01026106    PNF14658.1    GGMR01006408    MBY19027.1    NEVH01023961    PNF17613.1    NEVH01001355    PNF42855.1    ABLF02055645    AF012049    AAC24972.1    ABLF02034467    GBBI01001570    JAC17142.1    GBHO01008295    JAG35309.1    GGFJ01001857    MBW50998.1    PYGN01000192    PSN51582.1    NEVH01000280    PNF43672.1    GFXV01000774    MBW12579.1    GFTR01008271    JAW08155.1    PCG80496.1    GBYB01008290    JAG78057.1    ABLF02008463    ABLF02021177    ABLF02027367    ABLF02066338    GBBI01001642    JAC17070.1    NEVH01020963    PNF20308.1    NEVH01019964    PNF22161.1    NEVH01021205    PNF19912.1    NEVH01002704    PNF41489.1    ABLF02020655    ABLF02039168    ABLF02061060   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.0108134,     Score=93

Ontologies

Topology

Length:
579
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.15115
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03235
outside
1  -  579
 
 

Population Genetic Test Statistics

Pi
11.346254
Theta
15.351938
Tajima's D
-1.163221
CLR
0.129665
CSRT
0.112244387780611
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号