SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00819
Annotation
PREDICTED:_uncharacterized_protein_LOC105384490_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 2.822
 

Sequence

CDS
ATGTCAGAAGAAAAACCTGAACTGATGGTTATGACGCAGGAGCAATTCACGACACTCATTAACAAGTTATCAATTATAAACGAAGGTAGCCAACACAAAAGCAGTTTCGCTCGTTGCACAAAAAGGTACGACGGAGAAAGAAATCATAATAAAGTAGAAGAATTTATCACAAATATTACTATCTACAAGAAAATTGAAAAAATCACCGACGAAGACGCTCTCGAAGGATTAACGTTGTTACTAACAGGACAAGCAGCTACGTGGTGGAGTGGCGTCAAAGGTGAGATAAAAAAGTGGAATCCAGCTTTAGACGCGATCAGAAGTGCATTTGCCCCAAAAATGCAACCGCATGAAGTTTATCTGGAATTGTTTGCGAAGAAGCAAACAAACGAAACTATTGATGCATTCGTTTGTGACAAACGTGCCTTGCTATCGCATCTTCCAGCAAAAAGGCACAAGGAAGAAGAGGAACTGGATTTCGTATACGGACTCCTCAATATCCGCTTCAAAAAAGAAATTCCTCGCTATGAGATCAAATCGTTCTCAGAGCTATTGGAACGAGGTCGACATATTGAAAACCTTGCCAAAGAAGCCGAAGAAATTGCAGAAACTAGCCTGCGCACGGGTATTGAGAGGAAGCAGCCGAAAAGATGTTCGTACTGTGGCAAGAAAGGCCATTTTCAAGAAGTTTGCCGTAAAAGATTGTCAGAGGAAGCAATGGGAAAAAATAAGTCCTCAAGCGAAAGAGTACAGATAAGCTGTTATGGTTGTGGAGCACCGGGGGTATTTCGCAGCAACTGCGAAACGTGTAAAAACAATGAAACGCCGCCAAAACCAGTGTCATTTTACGCACTACAAACTACCATTAATAATGCCAAAATACCAACCATTGAAATCAACGTGAAAGGCGAACATGGCTACGCACACATTGATACCGCAGCTAGAACTAGTATGGCAGGTACACATTTGTACAAGACACTAGTATGTCAAGGTACTAAATTTGACGAAAAGCCAGCTGACGTCATCCTCGCTGATGGTACCAAACGAATAACGAAGCTACTGACTGCTACAGTGGATGTTGTGGTAGGAGGTCGACTTTTACCTGTCACATTTTCTGCAATGCCAGAAGCAGAAGACAACAGAACCCTGCTGGGTATAGATTTCTTGGAGAAGTTTGGAATTGTTCTAAATTTACCCCAACGAGTGTGGTACTTCTTGGATGACACAAAAGAAAAATTTCAGTTTATAAGATTGTCAAGCGACATAGTTCCGTTAAAGGCAGCTAGATCGCTGACCTTTAATGAGAGACCTTGCAAGATTGACAGCGGTGAAGCAGGTTTGAGCGATTTTCTAAAATACGCAAAGGAGTTAAAGATGCTTTCACCAATGAAAAATACTCCTTCACCACTTCACAGCGAACACGGTGATATCAGTCCCATCCCAACCAAGAAAGCCCGTTATGCATTGGTAAAATTGGACACACCGCCACGACCAGTGCGACCACGTGAACCAGCCGATGCAGCATCTTGTGTTGATCCTCGCATTACTTATTTACCAATAAATCCTATAAACATGTATTCTTTGGACATTTATTTGAAACCTCACGAAGGCTCTGTATTCAAAAATGAAGAACGAGTAGTATTCAATGATCTACTTCATGAATATAGGGACATATTTAATAAAAACGGAAATCCCACACCGTTCGCAGTACATAGAATAGACACGGGAACACATCCGCCTATTAGTGTTAAGCCCTACAGATTGTCACCAGCTCGACAAACACAACTTAGGGAAAAACTTGATGAAATGATTAGTAATGATATAATCGAAGAGAGTGATTCACCATGGGCAGCACCCGTTATTCTAGTACCAAAAGGGGATAACGACGTTCGAGTTTGCATAGATTATAGAAAACTAAATGAAATCACAAAACCAGATAGGTATCCATTACCACGTATTGATGACCTGCTTCATCAAGCAAAGGGGTTGCCATATATGTCTACACTCGACTTACAATCAGGATACTATCAAATAGTGGTAAATCCAGACGATCAAGACAAAACAAGCTTTATATCACCGTTTGGAAATTTTCGTTTTAAAAGAATGCCATTTGGATTACGAAATGCTCCAGCAACTTTTCAAAGGCTAATGGATAAATTTATACAAGGCTTAAAGACAAAGTACACACTAGCATACTTAGATGAGTGCATAACAAGAGCATACTCCTTTAAAGAGCATGTAGAGAATCTGCGAGAAATATTTAATAAGCTACGTGAGTACAATCTCAGAGCTAACAGAAACAAATGTAAATTTGGGTGCACAGAAATAAAATACCTAGGACATATTATTGTACCTGAGGGAATAAAGTCTGACCCAGAAAAGGTATCAGCAATTATGAAACTCAACAAACCCAAAACAATGAAACAATTAATGTCATTTCTCCAAACTGCGTCATGGTATCGAAGATTCATAAGAAATTTTGCACAAATTGCACAACCTTTGACCAATCTAACAAAGAAGAAAGTAAGTTGGAAATGGGAGTCAAAACAACAAGAAGCTTTCGACAAATTAAAGCTCGCCTTGACGACTGCCCCAGTCTTAAGACAAGCTAACACTAATTTACCTTTCACAATTAAAACAGATGCAAGCCAGTATGCTATAGGAGCAGCTTTAGTGCAGGGGGAGGGAGAAGAAGAACACCCAGTAGAATACGCAAGTAGACTCCTGAACACAGCTGAATGCAATTACACTGTAACTGAGAAAGAAGCATTAGCCATAGTTTGGGCTATTTCAAAGTTCCGAGGATACATAGAAGGAACAAAATTTGTGACTATAACAGATCACCAAGCGCTGAAGTGGTTAATGAATCTAAAAACTCCAACGGGTCGTCTAGCACGTTGGGCACTCCAGTTACAACCCTATGATTTCCAAATTAAGTATTCTCCAGGACGAACTAATGTCGTGGCCGACACTCTATCTCGACCACCATGTCAGGATCATGATGACGATTGTAACATTTGTCGAATAGATCTCGAGATGCCGAAACTTAATGAAAAACATTTAAGAGACGAACAATTAAAAGATGAAGTTCTAAAAAATATAATTGAAACCTTAGAAGAAGGGGGACATTCCATAAACTATGCTGAATATGTTAAAAAAGGATATATACTACATAAAGGTGTTTTGTATCTTTACACTCCAGAACAAGACGACGAAAATGCAAAGTTAGTAGTCCCTTGTCACGAAATAACTAACGTCCTTAAAGCGTTTCACGATTCCCATACTGCTGGACATATGGGAGCAGAAAGAACTCTTCAGCGAATCATAAATAAATTTTATTGGAAAGGGCAACGAAAAGATGTCATAAAATACGTGAAAACGTGTGAAGAATGTCAGAAATATAAACCTTCAAATCAGAAACCAGCAGGTTTATATCAATCTACTCCAAATACCCAGAGGTTTGAAGTATTATCAGTAGACTTGTTTGGTCCGTTACCAAAAGGCCTTTCTGGTGAAAAATGGATATTTATAATAGAAGACATGGCTTCACGATGGGTTGAAATGTTTCCGTTGAGAGAAGCTACAGGTAAAAGCTGCGCTTTGATTTTGCTAAATGAAATATTTCTCCGATACGGATTACCACGAAAAATTGTTTGTGATAATGGAGTACAGTTTATATCGGCAGTAATGCAAAAACTTACATACTGCTTAGAAATCCAACAAGTTTTCACTCCAGTATATCATCCTGAACCAAATGTAGTTGAAAGAAAGAATAGAGACATGAAAACACAAATAGCTATAATGGTTAAAGACAAACACCATTTGTGGCCGTCAACACTTCCAGCTATACGATTTGCAATGAATACAGCTCGTTGTCGATCTACATGCTTTTCACCAGCCTACTTAACGTTTGGAAGAGAACTACGGACACCGTACGAATTGACTCATGACCTTAGTTCGATAGTAGCATCTGAAAATTTTCTGGCAGAAATCACACCTAAGCTAAAACAACTAGCCCAGGATTTGAAGCTAGCAAGAGAAAATGCAGAGATCAACATGGATGAAGCTCGGCATAAATCAAATTATAAGAGAAGACCGGACCCAGGACATAAAGTTGGAGACCTAGTCTTAATAGAATCCCATCCTATTAGTAATCTTAACAAGCAATTTTCTGCCAAATTTGCACCAAAGCGAGATGGTCCTTATGTGATAATGAAGAAACACGAAGAAAAACCTGAACTGATGGTTATGACGCAGGAGCAATTCACGACACTCATTAACAAGTTATCAATTATAAACGAAGGTAGCCAACACAAAAGCAGTTTCGCTCGTTGCACAAAAAGGTACGACGGAGAAAGAAATCATAATAAAGTAGAAGAATTTATCACAAATATTACTATCTACAAGAAAATTGAAAAAATCACCGACGAAGACGCTCTCGAAGGATTAACGTTGTTACTAACAGGACAAGCAGCTACGTGGTGGAGTGGCGTCAAAGGTGAGATAAAAAAGTGGAATCCAGCTTTAGACGCGATCAGAAGTGCATTTGCCCCAAAAATGCAACCGCATGAAGTTTATCTGGAATTGTTTGCGAAGAAGCAAACAAACGAAACTATTGATGCATTCGTTTGTGACAAACGTGCCTTGCTATCGCATCTTCCAGCAAAAAGGCACAAGGAAGAAGAGGAACTGGATTTCGTATACGGACTCCTCAATATCCGCTTCAAAAAAGAAATTCCTCGCTATGAGATCAAATCGTTCTCAGAGCTATTGGAACGAGGTCGACATATTGAAAACCTTGCCAAAGAAGCCGAAGAAATTGCAGAAACTAGCCTGCGCACGGGTATTGAGAGGAAGCAGCCGAAAAGATGTTCGTACTGTGGCAAGAAAGGCCATTTTCAAGAAGTTTGCCGTAAAAGATTGTCAGAGGAAGCAATGGGAAAAAATAAGTCCTCAAGCGAAAGAGTACAGATAAGCTGTTATGGTTGTGGAGCACCGGGGGTATTTCGCAGCAACTGCGAAACGTGTAAAAACAATGAAACGCCGCCAAAACCAGTGTCATTTTACGCACTACAAACTACCATTAATAATGCCAAAATACCAACCATTGAAATCAACGTGAAAGGCGAACATGGCTACGCACACATTGATACCGCAGCTAGAACTAGTATGGCAGGTACACATTTGTACAAGACACTAGTATGTCAAGGTACTAAATTTGACGAAAAGCCAGCTGACGTCATCCTCGCTGATGGTACCAAACGAATAACGAAGCTACTGACTGCTACAGTGGATGTTGTGGTAGGAGGTCGACTTTTACCTGTCACATTTTCTGCAATGCCAGAAGCAGAAGACAACAGAACCCTGCTGGGTATAGATTTCTTGGAGAAGTTTGGAATTGTTCTAAATTTACCCCAACGAGTGTGGTACTTCTTGGATGACACAAAAGAAAAATTTCAGTTTATAAGATTGTCAAGCGACATAGTTCCGTTAAAGGCAGCTAGATCGCTGACCTTTAATGAGAGACCTTGCAAGATTGACAGCGGTGAAGCAGGTTTGAGCGATTTTCTAAAATACGCAAAGGAGTTAAAGATGCTTTCACCAATGAAAAATACTCCTTCACCACTTCACAGCGAACACGGTGATATCAGTCCCATCCCAACCAAGAAAGCCCGTTATGCATTGGTAAAATTGGACACACCGCCACGACCAGTGCGACCACGTGAACCAGCCGATGCAGCATCTTGTGTTGATCCTCGCATTACTTATTTACCAATAAATCCTATAAACATGTATTCTTTGGACATTTATTTGAAACCTCACGAAGGCTCTGTATTCAAAAATGAAGAACGAGTAGTATTCAATGATCTACTTCATGAATATAGGGACATATTTAATAAAAACGGAAATCCCACACCGTTCGCAGTACATAGAATAGACACGGGAACACATCCGCCTATTAGTGTTAAGCCCTACAGATTGTCACCAGCTCGACAAACACAACTTAGGGAAAAACTTGATGAAATGATTAGTAATGATATAATCGAAGAGAGTGATTCACCATGGGCAGCACCCGTTATTCTAGTACCAAAAGGGGATAACGACGTTCGAGTTTGCATAGATTATAGAAAACTAAATGAAATCACAAAACCAGATAGGTATCCATTACCACGTATTGATGACCTGCTTCATCAAGCAAAGGGGTTGCCATATATGTCTACACTCGACTTACAATCAGGATACTATCAAATAGTGGTAAATCCAGACGATCAAGACAAAACAAGCTTTATATCACCGTTTGGAAATTTTCGTTTTAAAAGAATGCCATTTGGATTACGAAATGCTCCAGCAACTTTTCAAAGGCTAATGGATAAATTTATACAAGGCTTAAAGACAAAGTACACACTAGCATACTTAGATGAGTGCATAACAAGAGCATACTCCTTTAAAGAGCATGTAGAGAATCTGCGAGAAATATTTAATAAGCTACGTGAGTACAATCTCAGAGCTAACAGAAACAAATGTAAATTTGGGTGCACAGAAATAAAATACCTAGGACATATTATTGTACCTGAGGGAATAAAGTCTGACCCAGAAAAGGTATCAGCAATTATGAAACTCAACAAACCCAAAACAATGAAACAATTAATGTCATTTCTCCAAACTGCGTCATGGTATCGAAGATTCATAAGAAATTTTGCACAAATTGCACAACCTTTGACCAATCTAACAAAGAAGAAAGTAAGTTGGAAATGGGAGTCAAAACAACAAGAAGCTTTCGACAAATTAAAGCTCGCCTTGACGACTGCCCCAGTCTTAAGACAAGCTAACACTAATTTACCTTTCACAATTAAAACAGATGCAAGCCAGTATGCTATAGGAGCAGCTTTAGTGCAGGGGGAGGGAGAAGAAGAACACCCAGTAGAATACGCAAGTAGACTCCTGAACACAGCTGAATGCAATTACACTGTAACTGAGAAAGAAGCATTAGCCATAGTTTGGGCTATTTCAAAGTTCCGAGGATACATAGAAGGAACAAAATTTGTGACTATAACAGATCACCAAGCGCTGAAGTGGTTAATGAATCTAAAAACTCCAACGGGTCGTCTAGCACGTTGGGCACTCCAGTTACAACCCTATGATTTCCAAATTAAGTATTCTCCAGGACGAACTAATGTCGTGGCCGACACTCTATCTCGACCACCATGTCAGGATCATGATGACGATTGTAACATTTGTCGAATAGATCTCGAGATGCCGAAACTTAATGAAAAACATTTAAGAGACGAACAATTAAAAGATGAAGTTCTAAAAAATATAATTGAAACCTTAGAAGAAGGGGGACATTCCATAAACTATGCTGAATATGTTAAAAAAGGATATATACTACATAAAGGTGTTTTGTATCTTTACACTCCAGAACAAGACGACGAAAATGCAAAGTTAGTAGTCCCTTGTCACGAAATAACTAACGTCCTTAAAGCGTTTCACGATTCCCATACTGCTGGACATATGGGAGCAGAAAGAACTCTTCAGCGAATCATAAATAAATTTTATTGGAAAGGGCAACGAAAAGATGTCATAAAATACGTGAAAACGTGTGAAGAATGTCAGAAATATAAACCTTCAAATCAGAAACCAGCAGGTTTATATCAATCTACTCCAAATACCCAGAGGTTTGAAGTATTATCAGTAGACTTGTTTGGTCCGTTACCAAAAGGCCTTTCTGGTGAAAAATGGATATTTATAATAGAAGACATGGCTTCACGATGGGTTGAAATGTTTCCGTTGAGAGAAGCTACAGGTAAAAGCTGCGCTTTGATTTTGCTAAATGAAATATTTCTCCGATACGGATTACCACGAAAAATTGTTTGTGATAATGGAGTACAGTTTATATCGGCAGTAATGCAAAAACTTACATACTGCTTAGAAATCCAACAAGTTTTCACTCCAGTATATCATCCTGAACCAAATGTAGTTGAAAGAAAGAATAGAGACATGAAAACACAAATAGCTATAATGGTTAAAGACAAACACCATTTGTGGCCGTCAACACTTCCAGCTATACGATTTGCAATGAATACAGCTCGTTGTCGATCTACATGCTTTTCACCAGCCTACTTAACGTTTGGAAGAGAACTACGGACACCGTACGAATTGACTCATGACCTTAGTTCGATAGTAGCATCTGAAAATTTTCTGGCAGAAATCACACCTAAGCTAAAACAACTAGCCCAGGATTTGAAGCTAGCAAGAGAAAATGCAGAGATCAACATGGATGAAGCTCGGCATAAATCAAATTATAAGAGAAGACCGGACCCAGGACATAAAGTTGGAGACCTAGTCTTAATAGAATCCCATCCTATTAGTAATCTTAACAAGCAATTTTCTGCCAAATTTGCACCAAAGCGAGATGGTCCTTATGTGATAATGAAGAAACACGGTACTTCTACCTATGATGTTGCACACCCAGATTCACCAGTTATATCAATTGGAAAATACCACTCCTCCGCAATAACAAAATTTGAGAAGAGAGATGATAGCATAGTCCAGCCGACTTATCCAATACGTCGTCGAGGACGACCACGTAAAACCTAA
Protein
MSEEKPELMVMTQEQFTTLINKLSIINEGSQHKSSFARCTKRYDGERNHNKVEEFITNITIYKKIEKITDEDALEGLTLLLTGQAATWWSGVKGEIKKWNPALDAIRSAFAPKMQPHEVYLELFAKKQTNETIDAFVCDKRALLSHLPAKRHKEEEELDFVYGLLNIRFKKEIPRYEIKSFSELLERGRHIENLAKEAEEIAETSLRTGIERKQPKRCSYCGKKGHFQEVCRKRLSEEAMGKNKSSSERVQISCYGCGAPGVFRSNCETCKNNETPPKPVSFYALQTTINNAKIPTIEINVKGEHGYAHIDTAARTSMAGTHLYKTLVCQGTKFDEKPADVILADGTKRITKLLTATVDVVVGGRLLPVTFSAMPEAEDNRTLLGIDFLEKFGIVLNLPQRVWYFLDDTKEKFQFIRLSSDIVPLKAARSLTFNERPCKIDSGEAGLSDFLKYAKELKMLSPMKNTPSPLHSEHGDISPIPTKKARYALVKLDTPPRPVRPREPADAASCVDPRITYLPINPINMYSLDIYLKPHEGSVFKNEERVVFNDLLHEYRDIFNKNGNPTPFAVHRIDTGTHPPISVKPYRLSPARQTQLREKLDEMISNDIIEESDSPWAAPVILVPKGDNDVRVCIDYRKLNEITKPDRYPLPRIDDLLHQAKGLPYMSTLDLQSGYYQIVVNPDDQDKTSFISPFGNFRFKRMPFGLRNAPATFQRLMDKFIQGLKTKYTLAYLDECITRAYSFKEHVENLREIFNKLREYNLRANRNKCKFGCTEIKYLGHIIVPEGIKSDPEKVSAIMKLNKPKTMKQLMSFLQTASWYRRFIRNFAQIAQPLTNLTKKKVSWKWESKQQEAFDKLKLALTTAPVLRQANTNLPFTIKTDASQYAIGAALVQGEGEEEHPVEYASRLLNTAECNYTVTEKEALAIVWAISKFRGYIEGTKFVTITDHQALKWLMNLKTPTGRLARWALQLQPYDFQIKYSPGRTNVVADTLSRPPCQDHDDDCNICRIDLEMPKLNEKHLRDEQLKDEVLKNIIETLEEGGHSINYAEYVKKGYILHKGVLYLYTPEQDDENAKLVVPCHEITNVLKAFHDSHTAGHMGAERTLQRIINKFYWKGQRKDVIKYVKTCEECQKYKPSNQKPAGLYQSTPNTQRFEVLSVDLFGPLPKGLSGEKWIFIIEDMASRWVEMFPLREATGKSCALILLNEIFLRYGLPRKIVCDNGVQFISAVMQKLTYCLEIQQVFTPVYHPEPNVVERKNRDMKTQIAIMVKDKHHLWPSTLPAIRFAMNTARCRSTCFSPAYLTFGRELRTPYELTHDLSSIVASENFLAEITPKLKQLAQDLKLARENAEINMDEARHKSNYKRRPDPGHKVGDLVLIESHPISNLNKQFSAKFAPKRDGPYVIMKKHEEKPELMVMTQEQFTTLINKLSIINEGSQHKSSFARCTKRYDGERNHNKVEEFITNITIYKKIEKITDEDALEGLTLLLTGQAATWWSGVKGEIKKWNPALDAIRSAFAPKMQPHEVYLELFAKKQTNETIDAFVCDKRALLSHLPAKRHKEEEELDFVYGLLNIRFKKEIPRYEIKSFSELLERGRHIENLAKEAEEIAETSLRTGIERKQPKRCSYCGKKGHFQEVCRKRLSEEAMGKNKSSSERVQISCYGCGAPGVFRSNCETCKNNETPPKPVSFYALQTTINNAKIPTIEINVKGEHGYAHIDTAARTSMAGTHLYKTLVCQGTKFDEKPADVILADGTKRITKLLTATVDVVVGGRLLPVTFSAMPEAEDNRTLLGIDFLEKFGIVLNLPQRVWYFLDDTKEKFQFIRLSSDIVPLKAARSLTFNERPCKIDSGEAGLSDFLKYAKELKMLSPMKNTPSPLHSEHGDISPIPTKKARYALVKLDTPPRPVRPREPADAASCVDPRITYLPINPINMYSLDIYLKPHEGSVFKNEERVVFNDLLHEYRDIFNKNGNPTPFAVHRIDTGTHPPISVKPYRLSPARQTQLREKLDEMISNDIIEESDSPWAAPVILVPKGDNDVRVCIDYRKLNEITKPDRYPLPRIDDLLHQAKGLPYMSTLDLQSGYYQIVVNPDDQDKTSFISPFGNFRFKRMPFGLRNAPATFQRLMDKFIQGLKTKYTLAYLDECITRAYSFKEHVENLREIFNKLREYNLRANRNKCKFGCTEIKYLGHIIVPEGIKSDPEKVSAIMKLNKPKTMKQLMSFLQTASWYRRFIRNFAQIAQPLTNLTKKKVSWKWESKQQEAFDKLKLALTTAPVLRQANTNLPFTIKTDASQYAIGAALVQGEGEEEHPVEYASRLLNTAECNYTVTEKEALAIVWAISKFRGYIEGTKFVTITDHQALKWLMNLKTPTGRLARWALQLQPYDFQIKYSPGRTNVVADTLSRPPCQDHDDDCNICRIDLEMPKLNEKHLRDEQLKDEVLKNIIETLEEGGHSINYAEYVKKGYILHKGVLYLYTPEQDDENAKLVVPCHEITNVLKAFHDSHTAGHMGAERTLQRIINKFYWKGQRKDVIKYVKTCEECQKYKPSNQKPAGLYQSTPNTQRFEVLSVDLFGPLPKGLSGEKWIFIIEDMASRWVEMFPLREATGKSCALILLNEIFLRYGLPRKIVCDNGVQFISAVMQKLTYCLEIQQVFTPVYHPEPNVVERKNRDMKTQIAIMVKDKHHLWPSTLPAIRFAMNTARCRSTCFSPAYLTFGRELRTPYELTHDLSSIVASENFLAEITPKLKQLAQDLKLARENAEINMDEARHKSNYKRRPDPGHKVGDLVLIESHPISNLNKQFSAKFAPKRDGPYVIMKKHGTSTYDVAHPDSPVISIGKYHSSAITKFEKRDDSIVQPTYPIRRRGRPRKT

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=1.60092e-75,     Score=727

Ontologies

Topology

Length:
2865
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00743999999999998
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00030
outside
1  -  2865
 
 

Population Genetic Test Statistics

Pi
183.590475
Theta
189.049128
Tajima's D
-0.65724
CLR
27.602433
CSRT
0.207139643017849
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号