SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00809
Annotation
PREDICTED:_nucleic-acid-binding_protein_from_mobile_element_jockey-like_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 4.562
 

Sequence

CDS
ATGGAAGCAAGACTTAAAGAGAAATTACCCCAGGAGGGTACCGGCGATGCCGGAGAATCCGTCCCTGAGCTTAGCTCAGGCTGCCCCGCGTATTCTGGGGGGGGCAAAGTAGTGCTGTCTGTGGAAAAACCAACAAAAACTTTGACCCAACAGTTATTTCACCCGGGTCTTTTTAATCGCCAACGATCCGCGTCACTGGGTGATGCCAGAGAACTAATTAAAAAACACAATGACAAACAACAAGAAAAACTCAACGAGCAGGAAAACAATGTGACTGATTTACATAATCCAAATATCCCATGGCAACGAATGCCAAACCAAAAAAGGAACCGTTCTCCTGAGGAAAATTCGCTTTCTAAATCTAATGAAGCCAAAAGGTTACATACAAGAAACCAACTGATCAGCCAAAACAGAGACATTACTGAATCTACAAGTAGACAAAGTCCAGAAATAGAAACAAGTAATCGTTACTCAATATTAGATGTTGAAGCTGATGACTCGGCTCTACAAAAGAAGACCCCCAAACCGCCACCCATTATACTATATGGTATTGAAGACCTTGCCAAATTAACAGAATTAATAGAACAAGTGTTGGAAAAGAATGACTACACCTTTAAAGTATCATCTAAAGACCAACTCATCATATCCTCTGCCACAATTGACAAGTATAAAATCCTTATAGAGCATATCAGAGCTAGAGGGCTAATAGGCCATACATTCACACGAAAGGATCAAAAATGTATGCGGATAGTAATCAAACATCTACACTTTAGCACACCTAAAGATGCCATCATTGATGCAATAGAGAAGACAGGTAACAAAGTACAAGGAGAGATCGTCACTGCACGAAAACCTGGCACCAAAGAACCATTAAATACATTTTTTGTCAATGTAGCATCCCATGAAAATAATAAACGTGTCAAAGATATAAAATTCATTTACCACCAAAAAGTAAAAATAGAAGACCCGAAACGAAAGACAACTATAGTACAGTGTACAAGATGTCAACAATATGGGCACAGCAAAAATTATTGTATGCGCCCATATAGATACGTAAAATGTGCTGGTCCACATAAGACAACATTGTGCACTATTGACAAAAATACCCCAGCTGTGTGCACTCTCTGCTCAGGAAGTCATCCTGCTAGTTACAAAGGATGTATGGTATACAAAGAAATTCTTACAAGGAAGAAAATGGCTAATAAACCTAACACGAAATATAAAATCAACTCTCTTGCTACAAAAGATCCAACAGTATATAGCGATACCCAAATAGAAACTGAAAAAGAAAGAAAAGTAAAAACCACCAAACAGCATGCTACTGTTCAAGAAAGTTTAAAACAATACAGTGAGGTTGTTAAAAAAGGTCTTGAAAATTCATCTCTCAAGAATCATACTTATGATCCAATCAAATATAAAAAAGATACGCAGGATCATCAGACATCATGGCCTTTAGATAACAGTACAGAAACACAGAGATCAGATACATACATAAATAGACATCAGCCAAGAACACAAAAACCTATGACAAAATACAACGATGACAATATGTCACAGAGAACACAATTAAAAAAAATAGATAGCGACAATGACACTCGAGAGCAAATACTTATGTTAGAAAAGGTCATAACAAGACAATCTGAAAGAATTGACCAACTTATAACACAGCTAAACACAATGATGAACCTTATCATTACACTCGTGAGTAAAGCTCCATAA
Protein
MEARLKEKLPQEGTGDAGESVPELSSGCPAYSGGGKVVLSVEKPTKTLTQQLFHPGLFNRQRSASLGDARELIKKHNDKQQEKLNEQENNVTDLHNPNIPWQRMPNQKRNRSPEENSLSKSNEAKRLHTRNQLISQNRDITESTSRQSPEIETSNRYSILDVEADDSALQKKTPKPPPIILYGIEDLAKLTELIEQVLEKNDYTFKVSSKDQLIISSATIDKYKILIEHIRARGLIGHTFTRKDQKCMRIVIKHLHFSTPKDAIIDAIEKTGNKVQGEIVTARKPGTKEPLNTFFVNVASHENNKRVKDIKFIYHQKVKIEDPKRKTTIVQCTRCQQYGHSKNYCMRPYRYVKCAGPHKTTLCTIDKNTPAVCTLCSGSHPASYKGCMVYKEILTRKKMANKPNTKYKINSLATKDPTVYSDTQIETEKERKVKTTKQHATVQESLKQYSEVVKKGLENSSLKNHTYDPIKYKKDTQDHQTSWPLDNSTETQRSDTYINRHQPRTQKPMTKYNDDNMSQRTQLKKIDSDNDTREQILMLEKVITRQSERIDQLITQLNTMMNLIITLVSKAP

Summary

Pfam
PF07530   PRE_C2HC
Interpro
IPR006579   Pre_C2HC_dom       

Ontologies

GO

Topology

Length:
572
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01221
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00071
outside
1  -  572
 
 

Population Genetic Test Statistics

Pi
184.420573
Theta
162.122672
Tajima's D
0.110615
CLR
0
CSRT
0.402029898505075
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号