SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00798
Annotation
PREDICTED:_uncharacterized_protein_LOC106648510_[Trichogramma_pretiosum]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Nuclear   Reliability : 1.816 PlasmaMembrane   Reliability : 1.269
 

Sequence

CDS
ATGCAAGGCATTGATAAAACGGACCCACCCCCCACAGACCCATTATTTCCTCAACCTACCTCAGTATGCAGAGTAGCCATAAAACTTCCTCCCTTCTGGCCTGATCGGCCTGCAATTTGGTTTGCTCAGGTAGAGGCACAATTCTCGATTTCAGGCATCTCCGCTGACCTGACTAAATTTAACTACGTGATTACTCAGTTAGATACCCGAGTTATTGGGGAGGTAGAGGACATTATTCTCCAACCACCACCTGAGGACAAATATGGTCGCCTCAAATCCGAGTTGATCCGTAGGTTGTCCACGTCTGGGGAGCAACGTGTCAGGCAACTTGTCAGTGATGTTGAGTTGGGTGACCGCCGTCCTTCGCAGTTTTTACGTTATCTTAGATCATTGGCAGGGAAAACCCTCACTGATGAAAATTTGCTTCGCCAGCTATGGATGCGTCGCCTCCCACAACATCTCCAAGCAATTTTGGCCGCCCAATCAGAACTCTCGCTGGACAAAGTCGCTGAGCTAGCGGACAAAATTTTGGAAGTTTCGCCTGGTATGGTCGCACCTCATTCATCTGCTGTTTTCTCAGCAATGTATTCAACCATGTACCTGGACGCCGCCGCCATCTTCGGAAAACGACAAAAGCAGTCAATGATGGCGACGTCTGACTGCTTAAAGGAGAGTCGCCGATTATTTGTCACCGAAAGCGCAACCAAGCGCCGTTTTTTAATAGACACAGGCTCCGACCTCTCCTGTTACCCATACCAGTGGTTAGCAAATAAGCCGGTACGTTCAAATTATACGTTAGCGGCTGCCAATGGTAGTGAGATACGCACTTTTGGTCACATAGAAATGGCGCTTAATTTGGGGTTACGCCGCACATTTCAATGGCGATTTATTATCGCTGACGTCAACACCGCCATCATCGGCTCCGATTTTCTGGCGCACTATCGGTTGTTGCCAGATTGTGCCAGTAAGAGACTCGTCGATAGCATTACCGGGTTGTCATGCGTTGCTGCCGTCACTGTTTTAGACCAGACCAGCGTCAAAGTTGTCTGCGCTCCGTCATCCCAATTTAGTGCACTTCTTGCGGAATTTCCGTCCATTACGAAGCCACCAGGACTTATTCGTGAGCCGAAGCATAACACAGTTCATTATATTCTAACCACTGAGGGCGCCCCAGTCTCTTGTCGTCCTAGACGTCTGGCACCTCAAAAACTTCAAGAGGCCAAAAAGGTTTTTGATGATATGGTACAGTGCGGGACAGCCAGACCTTCGAAAAGTTCGTGGTCTTCTCCACTTCATATGGTCCCTAAGCGCGACGGCACCTGGCGACCCTGCGGCGATTATCGTGCGTTGAATTCACGTACCATACCCGACAGGTACCCAGTTCGCCATATCGGTGACGTTGGCCATATCATATCTGGGTGTAGTATATTTAGTACAATCGACCTCGTTAAGGCATATCAGCAAATTCCTGTTGCGCCTGAGGATATCTGTAAAACCGCCATCATAACACCCTTCGGACTTTACGAATTTAATTACATGACTTTTGGTCTGCGCAACGCAGGCCAAACGTTTCAAAGATTTATAGACGAAGTTGTCCAAGGTCTCGATTTTTGCTTTGCGTACGTTGACGACATATTAGTGTATTCCCGTGATGCTCTTCAACATGCTGCACACCTTCGTACTCTTTTCAAGCGATTTGAAGATTACGGAATCGTTATAAATCCAGCAAAATGCGTGTTTGGTGCTTCTGAAGTTACTTTTCTCGGAAACAGAATATCCGCCAACGGAACACAACCACCATCAGAGCGCATTCAAGCTCTAAAAGATTTTCCTCTACCACAGACTGTACAAGGACTCCGTCGTTTCATTGGGATGGTTAATTATTTTCGCCGATTTCTGCGCAATGCGGCCAAGTTACAAGCACCGCTAGTCAACGCGATCGTGGCCACTGGAGGTAAAGGTCTCACACCGATCACTTGGACACCTGAGCTCGAAGAATGCTTTAATGCCTGTAAAGATAGCTTGTCATCTGCAGCTCTGTTGGCACACCCTTTGCCTAACGCTGAACTAGGGCTTTTCACCGACGCTTCCAGTTCTCACGTTGGTGCCTGCATTCAGCAGAAAGTCGGTGATGCTTGGCAACCCCTGGGTTTCTTTAGTAAAAAGCTGAATCCCCGACAGCGCCAGTGGCCAGCATACTACCGAGAACTTCTTGCGATATATGAGAGTGTGCAACATTATCGACATTTCCTAGCCGCACAGCACGTAACGATTTATACGGACCATAAGCCATTAGTTTACGCGTTCTCGCAACGTCGCGAAAGGCTTCCTCCGGTACAGTTAAATCAACTGTCTTTTATTTCGCAGTTTACCACGGACATTGTCCATATAAAAGGGGAGGACAATACGGTGGCGGACGCCATGTCCCGCATCGAAGCTGTTTGTTTTGAAACTGACCATTCTGCTCTCTCCGCTTGCCAAAAACTTGACGACGAATTGAAAAAGTATCGTAACGATGCGAATTCTTCTCTAAAACTAGAGAACGTCGTAGTTCCTGGCACAAACACTGTTTTGGTCTGCGACATGTCAACAGGGCGACCACGCCCATTTGTATCGGAACCTATGCGAAAGAAGATTTTTGCTCAGCTACATAATCTTAGCCATCCTGGTACTAGATCAACCATTCGATTGATCTCAGACCGTTTCGTGTGGCCTGGCATTGCCAAAGATTGCCGTTATTGGTGCCAAACCTGCGTTGCTTGCCAGCGAAGTAAGGTGACGCGGCATATAAAATCTCCACTTGGACACTTCTCCAGTCCTACGTCTCGACTGAAGCATGTCCATATTGACATCATAGGCCCTCTTCCATCTTGTTCTGACTTCCAATACTGCCTGACTGCTGTGGATCGCTACACTCGATGGCCCGAAGTTTGGCCTATGCACGGAATAACAGCAGAAGAAGTGGCGAGCACCTTTGTAGCCGGTTGGATTGCTCGATTTGGAGTACCTGCTGTCATCACTACCGACCAGGGACGACAGTTCGAGTCGGACCTTTTCAGACGCCTTACTAATTTATGTGGTACTAAACGTATACGCACTACTAGTTACCACCCTTGTGCCAATGGGCTCGTGGAGCGCATGCATAGACAATTAAAGGCCTCTCTGATGTGTTATGATGATTCGTGGTTGAATGCATTACCTTTGGTCTTATTGGGAATGCGTTCGGCTTTTAAAGAAGATCTACAAGCAACAGTAGCGGAATTGCTTTACGGAGAAACCTTAACGCTTCCAGGGGAACTGTTAGTACCTCCCGGTCCTTCTGGCTTCGAGGACCCGACGGATTTTGTCGTAAAGTTAAGACAGCGTATGTCTAAATTGCGTCCCACTCCATGTTCCTCACACACTAAACCATCACCTTTCATATTTAAAAATCTTTCCACCGCCTCTCATGTCATGCTCAGGGAGGATTCGGTTAGACGTTCAATGCAACCACCTTACTCTGGTCCTCATAGAGTTATATCTAGAGCCGAGGACGGAAAAACGTGGTCGATTGATGTAAAAGGGAAACAGGTGACGGTCAGTGTCGACAGAATTAAGCCAGCTTTCGTCGAGCATTCTTTAGTAGATCTCGTTCCAGCACCAGCACCGCGGGTTTCTGTGCCTCAACCAGCGCAACCAGATGCTACTAATGTCCCTTCATGTCCACTCGTGCCTTCGGCACCTCTAACTGCTACTCCTACACATACACCTCAATATACCACCCGGTCAGGTCGCAGAGTCCACTTCTCCAAACCTTTCGACCTATGA
Protein
MQGIDKTDPPPTDPLFPQPTSVCRVAIKLPPFWPDRPAIWFAQVEAQFSISGISADLTKFNYVITQLDTRVIGEVEDIILQPPPEDKYGRLKSELIRRLSTSGEQRVRQLVSDVELGDRRPSQFLRYLRSLAGKTLTDENLLRQLWMRRLPQHLQAILAAQSELSLDKVAELADKILEVSPGMVAPHSSAVFSAMYSTMYLDAAAIFGKRQKQSMMATSDCLKESRRLFVTESATKRRFLIDTGSDLSCYPYQWLANKPVRSNYTLAAANGSEIRTFGHIEMALNLGLRRTFQWRFIIADVNTAIIGSDFLAHYRLLPDCASKRLVDSITGLSCVAAVTVLDQTSVKVVCAPSSQFSALLAEFPSITKPPGLIREPKHNTVHYILTTEGAPVSCRPRRLAPQKLQEAKKVFDDMVQCGTARPSKSSWSSPLHMVPKRDGTWRPCGDYRALNSRTIPDRYPVRHIGDVGHIISGCSIFSTIDLVKAYQQIPVAPEDICKTAIITPFGLYEFNYMTFGLRNAGQTFQRFIDEVVQGLDFCFAYVDDILVYSRDALQHAAHLRTLFKRFEDYGIVINPAKCVFGASEVTFLGNRISANGTQPPSERIQALKDFPLPQTVQGLRRFIGMVNYFRRFLRNAAKLQAPLVNAIVATGGKGLTPITWTPELEECFNACKDSLSSAALLAHPLPNAELGLFTDASSSHVGACIQQKVGDAWQPLGFFSKKLNPRQRQWPAYYRELLAIYESVQHYRHFLAAQHVTIYTDHKPLVYAFSQRRERLPPVQLNQLSFISQFTTDIVHIKGEDNTVADAMSRIEAVCFETDHSALSACQKLDDELKKYRNDANSSLKLENVVVPGTNTVLVCDMSTGRPRPFVSEPMRKKIFAQLHNLSHPGTRSTIRLISDRFVWPGIAKDCRYWCQTCVACQRSKVTRHIKSPLGHFSSPTSRLKHVHIDIIGPLPSCSDFQYCLTAVDRYTRWPEVWPMHGITAEEVASTFVAGWIARFGVPAVITTDQGRQFESDLFRRLTNLCGTKRIRTTSYHPCANGLVERMHRQLKASLMCYDDSWLNALPLVLLGMRSAFKEDLQATVAELLYGETLTLPGELLVPPGPSGFEDPTDFVVKLRQRMSKLRPTPCSSHTKPSPFIFKNLSTASHVMLREDSVRRSMQPPYSGPHRVISRAEDGKTWSIDVKGKQVTVSVDRIKPAFVEHSLVDLVPAPAPRVSVPQPAQPDATNVPSCPLVPSAPLTATPTHTPQYTTRSGRRVHFSKPFDL

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
Belongs to the histone H3 family.
EC Number
2.7.7.12
EMBL
LBMM01001181    KMQ96765.1    LBMM01012479    KMQ86204.1    LBMM01013040    KMQ85849.1    + More
AAGJ04130731    LBMM01009142    KMQ88359.1    ABLF02030693    ABLF02030697    GBXI01015889    JAC98402.1    LBMM01013103    KMQ85815.1    KQ971355    EFA07205.2    AAGJ04112098    GBXI01017046    JAC97245.1    EF426679    ABP48077.1    AAGJ04001742    KL367778    KFD59660.1    GEGO01004484    JAR90920.1    KL367543    KFD65158.1    KL367544    KFD65142.1    AAZX01006801    AAZX01023483    LN877232    CTR11708.1    GGLE01003443    MBY07569.1    GEGO01003687    JAR91717.1    KQ973093    EFA13472.2    AAGJ04164195    AAGJ04164196    AAGJ04164197    GBXI01003773    JAD10519.1    GEGO01004649    JAR90755.1    GFDL01003994    JAV31051.1    LBMM01012134    KMQ86388.1    LBMM01012567    KMQ86146.1    GDKW01003376    JAI53219.1    GEGO01003506    JAR91898.1    KL367655    KFD60653.1    JYDT01000067    KRY86703.1    GGLE01001814    MBY05940.1    ABLF02040931    ABLF02040938    GGFK01003401    MBW36722.1    JYDR01000002    KRY79251.1    LBMM01012160    KMQ86374.1    GGFK01003442    MBW36763.1    ABLF02058233    GEGO01004475    JAR90929.1    AAZX01009606    DF142933    GAA49140.1    KL363241    KFD51254.1    GFPF01012375    MAA23521.1    GEGO01000286    JAR95118.1    JWZT01003175    KII67485.1    JWZT01005177    JWZT01001778    KII61927.1    KII71382.1    JWZT01004124    KII64665.1    JWZT01002058    KII70465.1    GACK01008900    JAA56134.1    AAZX01004786    ABLF02005645    ABLF02042063    GEGO01001281    JAR94123.1    AAZX01013940    KL367479    KFD72009.1    GDHF01021808    JAI30506.1    KL363373    KFD46409.1    GDHF01014424    JAI37890.1    GDHF01001116    JAI51198.1    GEDV01001796    JAP86761.1    JYDJ01000353    KRX36608.1    FN356213    CAX83702.1    GBYB01009311    JAG79078.1    MRZV01001828    PIK35719.1    AY013565    AAK07486.1    AY013563    AAK07485.1    GEGO01004686    JAR90718.1    AY013569    AAK07487.1    ABLF02006352    ABLF02013150    ABLF02013854    ABLF02041505    KL367564    KFD63933.1    JWZT01001363    KII72172.1    LBMM01012633    KMQ86092.1    AAZX01023342    AAGJ04000250    JYDV01000002    KRZ45603.1    BK004070    DAA04500.1    KL367552    KFD64647.1    CABG01000050    CAZ37786.2    KL367492    KFD69854.1    ABLF02057446    ABLF02059301    AAGJ04172791    NIVC01003188    PAA52757.1    AAZX01023279    BK004066    DAA04495.1    KL363200    KFD55401.1    BN000802    CAJ00250.1    KL367664    KFD60497.1    AAZX01023264    KL363454    KFD45607.1    KL363318    KFD47658.1    JYDI01000020    KRY58561.1    KRY58560.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF01087   GalP_UDP_transf
PF00078   RVT_1
PF00665   rve
PF17917   RT_RNaseH
PF00176   SNF2_N
PF00271   Helicase_C
PF05918   API5
PF13359   DDE_Tnp_4
PF00077   RVP
PF00125   Histone
PF16211   Histone_H2A_C
PF00013   KH_1
PF13733   Glyco_transf_7N
PF02709   Glyco_transf_7C
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR000477   RT_dom       
IPR034132   RP_Saci-like       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR005849   GalP_Utransf_N       
IPR001969   Aspartic_peptidase_AS       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001995   Peptidase_A2_cat       
IPR001937   GalP_UDPtransf1       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR041373   RT_RNaseH       
IPR013032   EGF-like_CS       
IPR016024   ARM-type_fold       
IPR014001   Helicase_ATP-bd       
IPR001650   Helicase_C       
IPR008383   API5       
IPR038718   SNF2-like_sf       
IPR027417   P-loop_NTPase       
IPR000330   SNF2_N       
IPR027806   HARBI1_dom       
IPR018061   Retropepsins       
IPR000164   Histone_H3/CENP-A       
IPR002119   Histone_H2A       
IPR032454   Histone_H2A_C       
IPR007125   Histone_H2A/H2B/H3       
IPR009072   Histone-fold       
IPR027791   Galactosyl_T_C       
IPR036612   KH_dom_type_1_sf       
IPR004087   KH_dom       
IPR003859   Galactosyl_T       
IPR029044   Nucleotide-diphossugar_trans       
IPR004088   KH_dom_type_1       
IPR027995   Galactosyl_T_N       
SUPFAM
SSF53098   SSF53098        + More
SSF54197   SSF54197       
SSF56219   SSF56219       
SSF50630   SSF50630       
SSF52540   SSF52540       
SSF48371   SSF48371       
SSF47113   SSF47113       
SSF54791   SSF54791       
SSF53448   SSF53448       
PDB
4OL8     E-value=1.59697e-66,     Score=647

Ontologies

Topology

Subcellular location
Chromosome  
Nucleus  
Length:
1268
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14784
Exp number, first 60 AAs:
0.0008
Total prob of N-in:
0.00347
outside
1  -  1268
 
 

Population Genetic Test Statistics

Pi
350.017987
Theta
229.601915
Tajima's D
3.235468
CLR
0.175757
CSRT
0.987300634968252
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号