SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00796
Annotation
PREDICTED:_uncharacterized_protein_LOC105842415_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.859
 

Sequence

CDS
ATGAGTGAGAAAGATCAAAAGGAGCTAGTTAAAAAACGAGCTAGTCTAAAAGGCCGATTGACTACATTCAGAAAGTACATCGAGGAATTGAGCGGTACGTTGAATCAGCAACAAGTCAATGAATTGCAATTAAGAATCGGTAAGATCGAATTATTATTTGAACAATATGACGTAGTACAAACTAAAATAGAATGCCTCGCTGACGATTTCAGCTCGCAAAGCACAGAGAGAGAAGATTTCGAATCGATTTATTACAAATCCCTTTCACAGGCTCAGGAGATTCTTTCTCGTAATTCTAAATTGTTACAAACCGATGCGCATAGTTTTGAGAGTTGTTCTCATGTGAGCAATCATCGCCTGGTTAAATTACCTACCATTAACCTACCCAAATTTAATGGTTCATATAATAACTGGCTGGAATTCCATGACACCTTCAGTAGTCTTATACATTCGAACGAGGCGATAGCAGAAATTAATAAATTCCACTACCTCAGGGCCTCGCTAGAAGGCTCTGCTGCTGTACTACTTCAGGAGATTCAGTTCTCTGCCAGCAACTATTCTGTGGCGTGGAAGCTGTTATGTGAGAGGTACGACAATAAGCGCCTATTAATTCAAACACATGTTAATAATTTATTTAATATAGACGCAATAAAGAGTGAATCTTCGTTTAATTTAAGACGTTTTATAGATCAGCTGAATAAAAGCCTGAGAGCTTTAGAGTCGCTGGACGAACCGACTGATCATTGGGACACTCTTCTCATCCACATGATGAGTCGTAAAATCGAACAGAAGACGCTGCGTGAATGGGAAGAGTGCAAAGGTCGTCTTGATAAAGAAAAGCCCATTTCTTTGTCCATATTTCTCGATTTCATTCGTAACCGGGCCGATCTATTAGAAACGATGGAATTTACTCGCTCTAACCTTCCTCACACACAAGTTCAGCCACCACAGTCGCCTAAAGGTCAGAAAATGAAAACATTAGTTTCTGTCTCCGGAACGCAGCCGTCGTCGAGTGGCGGTGCTAGTATTATTTCTGGTTCCGGTACAAAATCGTGCCCACACTGTAAGGGTGAGCATTATCTTTATAATTGCGATAAATTTCTGAGCCTTAATAATGAGCAGAGATGGGAATTAATTCCTCAGTTCAAGGTGTGTTACAACTGCTTTCGTAGTGGTCACTATTCGAATCGCTGCAAAAAAGATGGTTGTACTTTATGTAAGCGTAGGCATAATACGCTGCTGCACACCTATTCTAATAATAAACAGAGAATTAATCAGCCCGCTCCTAAGCGTGACACTACGGCAATCGCCTCCGCCGTCCAGCCTGAACCTCCTGGTAACCACGGCCTAACGTTAGCCACGTATTCTGCCGCCGCATCTTCAGAGATTAGTAAAGATGGTATATTTGCGACGGCTCTCGTTAAAGTTGTCGACAGTAATGGTCACGAGCACATCATACGTGCTCTTCTGGATTGTGCGAGTTCGTCTTGCATAATTAGTGAGAAAACGGGTCGCTTATTGAATGCCAAGTATATTGATATAGATAAACCTATTTTCGGCATTGATAAGACTAGAACTAACACTTCAAAAATGTGTTATGTTTCTTTCAGTTCACGCACTGAAAATTATTCCAAATGTCTTCTTTGTTATGTATTGCCGTCCATAACTGACGACGTGCCTTGCCATTCATTTGATGTTTCGCATTTAAATATTCCCGCTAATATTATTTTAGCCGATCCCCAATTTTATAAGGCGTCAGAAATTGACATGATAATTGGATCTAATATCTTTTGGGATCTGCTCGGGACGCGAAAGATCAATCTGGGAGATAGCATCTCGATCCTCTGGGAAACGCGACTTGGCTGGTTGGTGGTTTCCAGAGATCTAAGTGATGGTCATGGATCTGCTCCCCTAATGTGCAACTTCACAAAACTTGCAGACATTTCTCAAGATTTTGATCTCGGCGTTGATGACACTCAGAACTTGCTGTCGTGGTTCTGGCAGCTGAAGGAAGTAGGCCTTAAGTCATCATACTCCGAGGAGGAACGAAAATGTGAAGAACATTTCGTTAAAAATACGAAACGTCTAGCTGATGGTCGTTTTCGTGTGCGTGTACCCTTAAAACAATCTGCGGACTGCTTAAGTGACGGACAGCTCTAG
Protein
MSEKDQKELVKKRASLKGRLTTFRKYIEELSGTLNQQQVNELQLRIGKIELLFEQYDVVQTKIECLADDFSSQSTEREDFESIYYKSLSQAQEILSRNSKLLQTDAHSFESCSHVSNHRLVKLPTINLPKFNGSYNNWLEFHDTFSSLIHSNEAIAEINKFHYLRASLEGSAAVLLQEIQFSASNYSVAWKLLCERYDNKRLLIQTHVNNLFNIDAIKSESSFNLRRFIDQLNKSLRALESLDEPTDHWDTLLIHMMSRKIEQKTLREWEECKGRLDKEKPISLSIFLDFIRNRADLLETMEFTRSNLPHTQVQPPQSPKGQKMKTLVSVSGTQPSSSGGASIISGSGTKSCPHCKGEHYLYNCDKFLSLNNEQRWELIPQFKVCYNCFRSGHYSNRCKKDGCTLCKRRHNTLLHTYSNNKQRINQPAPKRDTTAIASAVQPEPPGNHGLTLATYSAAASSEISKDGIFATALVKVVDSNGHEHIIRALLDCASSSCIISEKTGRLLNAKYIDIDKPIFGIDKTRTNTSKMCYVSFSSRTENYSKCLLCYVLPSITDDVPCHSFDVSHLNIPANIILADPQFYKASEIDMIIGSNIFWDLLGTRKINLGDSISILWETRLGWLVVSRDLSDGHGSAPLMCNFTKLADISQDFDLGVDDTQNLLSWFWQLKEVGLKSSYSEEERKCEEHFVKNTKRLADGRFRVRVPLKQSADCLSDGQL

Summary

EMBL
NWSH01001945    PCG69607.1    NWSH01001014    PCG73111.1    KQ459312    KPJ01687.1    + More
KQ460211    KPJ16510.1    KQ460205    KPJ16960.1    NWSH01001201    PCG72150.1    GAIX01014054    JAA78506.1    KQ460500    KPJ14270.1    GEZM01086715    JAV59020.1    GEZM01012999    JAV92824.1    KQ977963    KYM98425.1    KQ458793    KPJ04955.1    GALX01005110    JAB63356.1    KQ460970    KPJ10166.1    KQ979276    KYN22031.1    KQ460545    KPJ14069.1    KQ977557    KYN02007.1    KQ982204    KYQ59009.1    KQ981002    KYN10407.1    GBHO01005506    GBHO01005503    JAG38098.1    JAG38101.1    KQ976954    KYN06860.1    KQ981127    KYN09299.1    KQ977342    KYN03430.1    KQ973442    KXZ75531.1    KQ979016    KYN24380.1    KQ978855    KYN27942.1    GGMR01014413    MBY27032.1    ABLF02022040    ABLF02056888    JTDY01006550    JTDY01002030    JTDY01001260    KOB65898.1    KOB72276.1    KOB74365.1    GGMS01001896    MBY71099.1    KQ977691    KYN00577.1    KQ977081    KYN05932.1    GEZM01055231    JAV73081.1    GEHC01000870    JAV46775.1    GGMR01009911    MBY22530.1    GGMR01020322    MBY32941.1    QOIP01000005    RLU22365.1    KQ977505    KYN02283.1    GGMS01000724    MBY69927.1    GFTR01008874    JAW07552.1    GBBI01004140    JAC14572.1    GBGD01000063    JAC88826.1    GBBI01004139    JAC14573.1    GGMR01018506    MBY31125.1    ABLF02042806    GGMR01011015    MBY23634.1    GGMR01013586    MBY26205.1    GGMR01017803    MBY30422.1    ABLF02023723    GALX01004000    JAB64466.1    GBBI01004211    JAC14501.1    GGMS01005792    MBY74995.1    ABLF02023842    ABLF02028949    ABLF02058391    ABLF02041599    ABLF02016109    ABLF02016113    ABLF02006001    ABLF02006002    ABLF02042264    ABLF02026305    ABLF02055387    KQ980805    KYN12751.1    LKEX01009637    KYN50127.1    GEHC01000869    JAV46776.1    KQ977311    KYN03597.1    GGMR01015704    MBY28323.1    ABLF02016099    GGMS01010815    MBY80018.1    CR954257    CAJ14165.1    ABLF02007122    ABLF02033517    ABLF02011452    GEHC01000939    JAV46706.1    GEHC01000864    JAV46781.1    ABLF02021176    ABLF02066403    KQ977526    KYN02131.1    GGMR01020500    MBY33119.1    ABLF02031260    ABLF02041727    KK107397    EZA51360.1    LBMM01008722    KMQ88672.1    ODYU01010476    SOQ55616.1    GGMR01005292    MBY17911.1    GBBI01004032    JAC14680.1    ABLF02018588    ABLF02018590    ABLF02042430    GEZM01066272    JAV68024.1    ABLF02028302    ABLF02041631    GGMR01000832    MBY13451.1    GEZM01086714    JAV59026.1    KQ977737    KYN00241.1    ABLF02012925    ABLF02012929    ABLF02012930    ABLF02041519   
Pfam
PF03564   DUF1759        + More
PF18701   DUF5641
PF05380   Peptidase_A17
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF07679   I-set
Interpro
IPR036397   RNaseH_sf        + More
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR001878   Znf_CCHC       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR021109   Peptidase_aspartic_dom_sf       
IPR041588   Integrase_H2C2       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR000477   RT_dom       
IPR003598   Ig_sub2       
IPR036179   Ig-like_dom_sf       
IPR013098   Ig_I-set       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
IPR013783   Ig-like_fold       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF48726   SSF48726       
Gene 3D

Ontologies

Topology

Length:
719
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000640000000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00024
outside
1  -  719
 
 

Population Genetic Test Statistics

Pi
2.351806
Theta
14.049873
Tajima's D
-2.494044
CLR
102.039507
CSRT
0.000199990000499975
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号