SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00787
Pre Gene Modal
BGIBMGA009703
Annotation
Retrovirus-related_Pol_polyprotein_from_transposon_TNT_1-94_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 2.752
 

Sequence

CDS
ATGGAGAAAACGAGAGCCTTGCTTTTGGATGGAGCTGTACCCAAATATCTCTGGGGAGAAGCATTACTAACGGCTAGCTTCTTATTAAACCGATGTCCAACAAAAGGAAAAAATAAAACTCCTGCGGAATTGTGGTTTGGAATAAAACCAGATGTTTCAAATATTCGAAGATTTGGCTCAACTACATATTTTAAAATAAATTCTGGACTAAAAAAGCTTGATGATCGTTGTAAAAAAGGTATTCTGGTTGGCTACGTAAGAAACGGTTATAAAATTTGGGTTGAAGATGAACAAAAAATTATAAGAGCAAGGGATGTAAGAATTAATGAGGGAGAACAAGGAATTCTAGGTGGATACTTAGAAGATAATGAAGTAATTAATGGGCTTTGGGGTGATGAAAGGGAGAACACTAATAGAAATAATACAAATGAAAATAATCGTGCAGATGATGAAGTCAGAGAAGTTCGAGAAGGTGATTTTAGAGGAAATAATAGTAATGGAGTTAATGAAGTTCGAGAAGATGTTGTTATAAGGCAAAATAATAGAGGAAGAAATGAAAATCGAGTAGAAAGAGGAAGAATCATAAATATTGAAGAAACAAATATATTTAGTGAAACAAATGAAGATGAAACAATTGAAGGTGAAACAAATGACAGAGGAACAAATGCAAATGAAAAAAATGAAAATGGAACAAATGATAGCCCATTAACAAATGAAAATCTGGTGGAGACTTTAAGAAGTAATGATGATATGGATGAAAGAGAAGAATTTCTTGACAGTGAAAATACTGAGGGAATTAATGAACAAGTTTTAGAAAATACAAGAACTGGAAGACCGCAGCGGAACAGAAGACCACCAGACAGATACAAAGATTTCATAATGGAAGATGGAGAATTCTCTTTATTGACGTTCGAGGAAGCAATTGAATCAAAAGAAAAAGAAAACTGGTTAAAAGCTATTAAAGAAGAAATGGATTCTTTAAAAGAAAATAATACATGGTCTTTAGTTGACAAGAAGGAGGCCGAAGGAAGAAAATTGGTTACAAGTAAATGGATTTTTTCTGTAAAAGCTGACGGAAGATATAAAGCTAGACTTGTTGCTAGAGGTTTTCAACAAAAATATAAAATAGATTATGATGAAACATATAGTCCGGTTATAGACACTACTTCTTTGAGAATTTTATTGTCTATTGCAGCTGATAAAGGGTTAAAATTAAAACAATTTGATATTAAGACTGCGTTTCTCCATGGAAATTTAAAGGAAACAATATATATGAAGGTTCCAAAAGGCTACAATAACTGTGAGGGCAAAGTATGCAAATTAAATAAAAGCTTATATGGTTTAAAACAGGCTCCCCTAATGTGGAATATACGTTTTACAGAATTTTTATCAGAAATTGGTTTCAGACAATTGAAATTAAATAAATGTATATTCATTTTAGATATGACAGAAAATAAAAGAATCTATTTAGGAATTTATGTAGATGACGGAATAATAATCGGCGAAAATTTGAAAGATTTAGAGGAAATTATAAATAAATTGAAAAAAGAATTTGATTTAAGGGTTTCTGAGAGAGTATCTAATTATATTGGTTTAGAAATCGAGACAGAAAAGAGTGGTATTAAATTACATCAACAAAAATATTCGGAGAAATTATTACAAAAATTTAATATGAACAATGTGAGAGATTGCAACTACCCGAGTATTTTGGTGGAGCAACATCCATCAGTCAAAGTCGATAAGAAAATGCACGAAGACTATAGAGAAATGGTAGGTTCTCTGCTTTATCTCTCAAACAAAACAAGACCTGACATTAGTTTTCACGTAGGCTATTGTTCAAGGCATCAAAACAGTCCAAATTTAAATGATTTAAACAATGTTAAAAATATTTTGAGGTTTATTAAAAGTTCAAAAGAAAAAGGTATTCATTACAGTAAAGGTGACAATATATTGAGAGGTTTTTGTGATTCTGATTTCGCTGGTGATCCTGACACGAGACGAAGTACTTCTGGTTTTGTGATCTGGATGAATGGTGGACCAATTGCATGGAGCTCAAGAAAACAATCAGTTGTGGCACTTTCGAGCACTGAAGCTGAGTATATTGCTGCTGCAGAATGCTGTAAGGAACTGCTATATATTAGAGATCTGGTAAAAGAAATTACGAATGAAAATTTGGATATTGAAATGCGAGTTGACAACCAATCTGCGATTTGGCTTATGAAGAAAGGAATTATGAATAAAAGAAGCAAACACATTGATGTTAAATATTACTACCTTAAAGAAAAGATTGATGAAAACCAGATTAAAGTTAAATACTGTCCAACTGGGTCACAGATTGCGGATATTCTAACGAAAAGTTTACCCAGGATAAAGTTTGAAAGCTTTGAGAAGGAGATAAAGGAGTTTAAAGGTAATAGAGTCAAAAAGGAGTTAAAGGTTAGAGTCAAAAAGGAGTTAAAGGTTAGAGTCGAGAAGGAGTTAAGGGTTAGAGTCGAGAAGGAGTTAAGGGTTAGAGTCGAGAAGGAGTTAAAGGTTATTAAAGAGGTTGAGAAGGAGTTAAAGGTTATTAAAGAGGTTGAGAAGGCGTTAAAGGTTATTAAAGAGGTGGAGAAGGCGTTTAAGGTTATTAAAGAGGTTGAGAAGGCGTTTAAGTGCGTAGTTTTCGATGAAGAATTAGACAGGCAAGCGCCAATACACTTTCTCGTAGTACCGAAGAAGGTAATTCCAGTCATGTCGGAAGCATCAGTGGATGACGAAAAAATTATTGGTCACCTCTTATTGGTTGCAAATGAAGTAGCCACAAAAAAAGGATTATACCGACAAGGATACCACGTGTTTTTAGATGAGAATCACAAAATAATGAAATTGAAAGCTCTTCACGTATTCGGACGAGCTTTACATCACATGGTCTGGCCGAGCGGTCCGGGGGCGAGACTTTAA
Protein
MEKTRALLLDGAVPKYLWGEALLTASFLLNRCPTKGKNKTPAELWFGIKPDVSNIRRFGSTTYFKINSGLKKLDDRCKKGILVGYVRNGYKIWVEDEQKIIRARDVRINEGEQGILGGYLEDNEVINGLWGDERENTNRNNTNENNRADDEVREVREGDFRGNNSNGVNEVREDVVIRQNNRGRNENRVERGRIINIEETNIFSETNEDETIEGETNDRGTNANEKNENGTNDSPLTNENLVETLRSNDDMDEREEFLDSENTEGINEQVLENTRTGRPQRNRRPPDRYKDFIMEDGEFSLLTFEEAIESKEKENWLKAIKEEMDSLKENNTWSLVDKKEAEGRKLVTSKWIFSVKADGRYKARLVARGFQQKYKIDYDETYSPVIDTTSLRILLSIAADKGLKLKQFDIKTAFLHGNLKETIYMKVPKGYNNCEGKVCKLNKSLYGLKQAPLMWNIRFTEFLSEIGFRQLKLNKCIFILDMTENKRIYLGIYVDDGIIIGENLKDLEEIINKLKKEFDLRVSERVSNYIGLEIETEKSGIKLHQQKYSEKLLQKFNMNNVRDCNYPSILVEQHPSVKVDKKMHEDYREMVGSLLYLSNKTRPDISFHVGYCSRHQNSPNLNDLNNVKNILRFIKSSKEKGIHYSKGDNILRGFCDSDFAGDPDTRRSTSGFVIWMNGGPIAWSSRKQSVVALSSTEAEYIAAAECCKELLYIRDLVKEITNENLDIEMRVDNQSAIWLMKKGIMNKRSKHIDVKYYYLKEKIDENQIKVKYCPTGSQIADILTKSLPRIKFESFEKEIKEFKGNRVKKELKVRVKKELKVRVEKELRVRVEKELRVRVEKELKVIKEVEKELKVIKEVEKALKVIKEVEKAFKVIKEVEKAFKCVVFDEELDRQAPIHFLVVPKKVIPVMSEASVDDEKIIGHLLLVANEVATKKGLYRQGYHVFLDENHKIMKLKALHVFGRALHHMVWPSGPGARL

Summary

Uniprot
ProteinModelPortal
PDB
5KM9     E-value=2.0554e-11,     Score=170

Ontologies

GO

Topology

Length:
979
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.2076
Exp number, first 60 AAs:
0.20742
Total prob of N-in:
0.00929
outside
1  -  979
 
 

Population Genetic Test Statistics

Pi
403.800635
Theta
183.121989
Tajima's D
4.288992
CLR
0
CSRT
0.999600019999
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号