SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00781
Pre Gene Modal
BGIBMGA000917
Annotation
reverse_transcriptase_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.906
 

Sequence

CDS
ATGTTTACAAAAGCACGCAGCAACTCACTCGGTACTATACCGCAAGATATCAACGTCCCTGAAATAATATTTAGTACGAAAGATCAAATCAAGCACGACTGGCAGCAGGACAGAATTCCGCCAGCCAAAAGAAAGAGAGTGGAAACCGACTCCCCACAGACTGAAAAGGTAAAGAAAAAGCCTAACACAACTACTTATGCTATTACTACAAAGAATCAATTCGATATTTTAGACAGTGAGGAATCTACAACAGACAATATAGAAATAGAAAAACCACCAAAACCAGAACCAATATTTGTTACTGGTGTCCTGGATATCAGCGCCCTCCGAAATAAATTGAAAGAAATTGCATCAGCAGACGACTACACTATGACAACACTCAAGTCAGGACACATTGTGAAAATAATGCCAGCAAGTATAGAAATATATAAATCAATACGAGAAAATTTTATCTCAGACAATATTAGCCATTACACATACATGTTAAAGAGCGAAAGACCATACAGAGTTGTACTGAGAGGCCTCCACAGCTCAGAGGATACTACTGAAATAAAGGAAAAACTCAAAAAACACGGGCACGAAGTAAGGCAAATTGTGAATGTACGCCACCGAACCTCAAAAGAACCTCTACCTTTGTTCTATGTAGACCTGGAACCCAAGCCAAGCAATAAAGATATATTTAATTTAAAATTCCTAAATCACATGAAGGTATCGTTCGAACCGCCCTACAAGAAAAAAGAAATTATCCAGTGTAAGAGGTGTCAAAGATTTGGTCACTCTAAAAATCAGTGCTACCGACCTTTCAGATGCGTCAAGTGCGGAGAAGACCACCCCACCAGCACCTGTAAAAAAACTAAAGACACAGAAGCTACATGTGCGAACTGTCAACAAAAGCACCCTGCTAGTTATAGACGATGTGTTAAATATAAACAATACAAGGAGCATATACTGAAAATACAACCGAAAAACACGCACACAAATATAATAAACAGACAAACCAGACTCCCAGATGTAGATATTCCACAACCTAAGAAATTTAGTACCAGTAATAAAAATAGACTAACTTATGCTGAAGCAATAAAATCTAAAACAGACAACATAATTAACTCAAACGAACCGCTTCAAGTGCAACAACTGGGTGACATCCTGGATAAGATGTTCAACAGAATTCAAACCATGATGATGAACATGGTAGACAACATGATGGACAGGGGCTATACTATCTACAACACTAATCATCCATCAGGAAGTGCACATGGAGGAACGGCAGTACTTATAAAATCTAACATAAAACATCACCCGCTCGAACCATTCGCGACAGACAAGATACAAGCTACACTCATCAAAGTCAGTGACAAAAGTTCGGACATTACAATTGCTGCAGTCTACTGCCCGCCCAAACCTCAGATATCACGGGAAGACTATAATAATTTCTTCTCTAAACTCGGACACCGTTATATAAGCGGAGGCGACTGGAACGCTAAACATACGTTCTGGGGTTCCAGGCTTGTAACAACTAGAGGCAGACAACTCTACCAAGCTGTTAAAGATCTCAACCTTGACTGCTTATCAACAGGTGAACCTACCTACTGGCCGACTGATCCACGAAAAACTCCTGATCTACTGGACTTCTTCATAACAAAAAATATTATAATCAATAACACCAGTGTGGAATCTGACTTAGATCTCACATCAGACCATTCTGCAGTTATTCTAAACCTGAATAATAAGATAATATTAAATGATGCACCACCCAGAATCTACAATAAAAAAACAAACTGGGAAGAATACAAAAATATTATCACAGCAGAAGCACAGCTCATAGTGCCACTGAAAACAGTAGAAGAAGTTGAACAAGCCATTGAAAACCTAAATGGATTGATCCATAGCGCAGCTAATAGGTCCACACCCCAAGGTAAAGCTAGTAGTGCTAAAGAGCATGTATACCCTGCGTTCATTAGGGACAGAGTAACTGAAAGACGTCGACTCCGCAGAGAATGGCAAAACAACCACTATAAAAGAGACAAAACTGCTTTTAATAAAGCATCGCAGCAACTAAAGGCGCTAACGAAACAATGGGCAAATGAGAACTTACAAAGTTACCTCACAAAGCTGACACCTACTAGTGACACAAATTACTCTCTGTACAAAGCTACAAAAAACATGAAGCGTCCAAAACAACAGGCTACACCTATAAAAACACAACTAGGGACCTGGGGCCGCTCCGACGGTGAGAAAGCTACTACATTTGCAGAGCATTTACAAAAAGTATTTGAGCCACCTCCCAGCAACGACCAAAGCCTAGACAATGAAATAGACGAATACTTAAGTTCTCCAAATCAGATGTGCCTACCGTTGAAACATGTCACGCTTAATGAACTAAGACGGGACATCCGAAAACTTAAACAAGGTAAATGCCCCGGCTATGATCTCATTGACGCTACTCTCTTAAAACATCTTCCAAAAAAGGGACTTCTGCTCATACTTGCTATCTTAAACGCATGTCTAAGATTATCCTTCTATCCAAGCCAGTGGAAAATAGCCCAAGTCATTATGATACAGAAGCCAGGAAAACCAGCTCAAGATGTGACATCATATAGACCCATAAGTCTTCTTCCTGTTGTTGGAAAAATACTTGAAGGGACTGTGCTAAACAGAATGCGAGAACACCTAGCAGAAATAATACCAACCCACCAGTTCGGCTTTAGAGAAGGTCACGGCACTATCGAGCAAGTACATCGTTTAGTTGATGTCATTGGGAGAGCGCTGGAAAACAAATTATATTGTTGCGCAGCCTTCCTAGACATTTCCCAGGCTTTTGACAAGGTTTGGCATAATGGGCTGCTTTACAAAATTAAAAAAAAATGTTGCCACATTCATTTTTCCCACTACTTCAATCATACCTTGTAA
Protein
MFTKARSNSLGTIPQDINVPEIIFSTKDQIKHDWQQDRIPPAKRKRVETDSPQTEKVKKKPNTTTYAITTKNQFDILDSEESTTDNIEIEKPPKPEPIFVTGVLDISALRNKLKEIASADDYTMTTLKSGHIVKIMPASIEIYKSIRENFISDNISHYTYMLKSERPYRVVLRGLHSSEDTTEIKEKLKKHGHEVRQIVNVRHRTSKEPLPLFYVDLEPKPSNKDIFNLKFLNHMKVSFEPPYKKKEIIQCKRCQRFGHSKNQCYRPFRCVKCGEDHPTSTCKKTKDTEATCANCQQKHPASYRRCVKYKQYKEHILKIQPKNTHTNIINRQTRLPDVDIPQPKKFSTSNKNRLTYAEAIKSKTDNIINSNEPLQVQQLGDILDKMFNRIQTMMMNMVDNMMDRGYTIYNTNHPSGSAHGGTAVLIKSNIKHHPLEPFATDKIQATLIKVSDKSSDITIAAVYCPPKPQISREDYNNFFSKLGHRYISGGDWNAKHTFWGSRLVTTRGRQLYQAVKDLNLDCLSTGEPTYWPTDPRKTPDLLDFFITKNIIINNTSVESDLDLTSDHSAVILNLNNKIILNDAPPRIYNKKTNWEEYKNIITAEAQLIVPLKTVEEVEQAIENLNGLIHSAANRSTPQGKASSAKEHVYPAFIRDRVTERRRLRREWQNNHYKRDKTAFNKASQQLKALTKQWANENLQSYLTKLTPTSDTNYSLYKATKNMKRPKQQATPIKTQLGTWGRSDGEKATTFAEHLQKVFEPPPSNDQSLDNEIDEYLSSPNQMCLPLKHVTLNELRRDIRKLKQGKCPGYDLIDATLLKHLPKKGLLLILAILNACLRLSFYPSQWKIAQVIMIQKPGKPAQDVTSYRPISLLPVVGKILEGTVLNRMREHLAEIIPTHQFGFREGHGTIEQVHRLVDVIGRALENKLYCCAAFLDISQAFDKVWHNGLLYKIKKKCCHIHFSHYFNHTL

Summary

Pfam
PF00078   RVT_1        + More
PF07530   PRE_C2HC
PF14529   Exo_endo_phos_2
PF04937   DUF659
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR006579   Pre_C2HC_dom       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR007021   DUF659       
SUPFAM
SSF56219   SSF56219        + More
SSF140996   SSF140996       
SSF53098   SSF53098       
Gene 3D
PDB
1WDU     E-value=0.000330274,     Score=108

Ontologies

GO

Topology

Length:
969
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.853780000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  969
 
 

Population Genetic Test Statistics

Pi
282.34181
Theta
166.45662
Tajima's D
2.061254
CLR
0.924445
CSRT
0.892205389730513
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号