SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00769
Annotation
non-LTR_retrotransposon_R1Bmks_ORF1_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 0.919
 

Sequence

CDS
ATGTCGGAGGAGGAGAGGGGGCTATTTTCCCCTCGGGTATCTTTGGCGCGCTCGCCGCCTAGGGGACTGACTGCACCTCTGCCGGCGCCTATGCCGCCGCCGGCCCCCCGGGGGGTTAGGGCGGGAGCGGCTGTGAGTGCCAAAGGCCGGAGGACCGGCCTGCATATCCCGGTTGCTTCTGGACTGTCGTCCTCGGCGCCTGTCACCCCGGTTGACCCAGAGGCTGGTGTCCCTAGCTTCCCCATTCCTGTTGCGTCGGGGGCTCCGACTGGACCCCTTGATGTAGCAGCGCAGGGGAGGCTGGAGCTGCTCGAGCGGGCAAACAGAGCGGTGCGCGGGATCATGTCGGTGGCGACGGCTGCATCTAAGCTCAATAAGTCGGAGGTCAATCTAATCTCCGAACTCGGTCGCGATATCCTGGCCGTAGTTGGGGCCCTCGGGATCCAGCTCTCTGATAAGGAGCTGGTGGTCGAAAGGCTCCGCTCGGCAGAGGCCTCTGCACGGCGTGACTCCGTGGCGCCTTCGATGGCTGCTGGTGCGGCGGCCGGGTCTGGGACTGGGCCTGCGACCTTCGCCACTGTCCTCAGGACGGGCCCTGGTGGGGTCCCGAGGTCCATTGGGGCCTCTCAGGGGCCTTCCTTGGCATTCTACCCGTCCGAGGGCAATGCGGAACTGAAGACAGCTGAGGACACAAAGAAAGAGGTAAAAAAGGCCATTGACCCTAAGTCAATGGCTATTGGAATACAGAGCGTAAGGAAGGTTGGGAATGCGGGGGTAGTGGTGCAGACCACGTCCCCCGCGGCCGCAGTCAAGCTTAGAAATGCTGCCCCGCCATCACTGAGAGTCACTGAACCCAGGCGCCGACAGCCCTTAGTAGCTGTCAATGGCGTGGAGGGCGACCCCTCCTTCGAGGAGGTAATCGAGTGCCTGGCTAGCCAGAACCTCGACCCGGAGGAGTGGCCCCTCACTAGGGTACGAGCGGAGCTCACGGGGGCGTTCAAAAAGGGGAGGCGACAATCCAACAACACTACTGTGGTGTTTAACGCCTCCCCTCGCATCAGGGACGCCCTCGTGAAGATTGGCAGAGTGTATGTGGGGTGGGTCGCCTGTGAGGTCACGGACTTTGTCCGGGTGACCTGCTGCAATAAATGTCAGCAATATGGTCACCCGGAGAAATTTTGCCGGGCCAAGGAGGCCACCTGTGGCCGATGTGGAGAGGATGGCCACCGAATGGAGGCCTTGCACATTGGGGGGTGGGACTTATATATGGTGTCTGCGTACTTCCAGTATAGTGACCCTATTGACCCATACCTGCACCGGCTCGGGAATATTCTTGACCGGCTGCGGGGGGCTCGGGTCGTTATCTGCGCAGACACTAATGCCCACTCGCCATTGTGGCACTCGCTGCCCAGGCACTACGTCGGTCGGGGTCAGGAAGTGGCTGACCGCCGCGCCAAGATGGAGGATTTCATTGGGGCGAGGCGGTTGGTCGTCCATAACGCGGATGGCCACCTGCCGACCTTCAGTACGGCGAACGGAGAATCTTATGTCGATGTCACGCTGTCTACGCGGGGAGTACGCGTGTCTGAATGGCGTGTAACTAATGAATCATCGAGCGATCACCGGCTCATTGTGTTTGGGGTGGGGGGCGATACAACAGGGGAGCGGAACGAGGACGAGGAGGCGCGGAGCGATTTGAGGCCGGATGAGCCGTGCGCACTGCGTCGGTACCGGGACCGTGGGGTGGATTGGGACCTCTTCAGATCGCGTATCCATGAGCGAATGGGGAGTCTGGACCTCGAGGAACCTGTGGCTGCCCTTTGCGAAAAATTTACCGGGGTTATAACTCGCACCGCTGCAGAATGCTTAGGATCACTGAAAGCAGATAGAACTGACAGGGGTTATGAATGGTGGACCCCAGTACTCGATAAGCTTAGGGTAGCCCAGGGTAGGGCCAGGCGTCGATGGCAAAAGGCCCGCCGAACAGGGGGTGAGGAAGAGGAGCAGTCTGGGAGAGTCTTCCGCGACCGCAGGCGCGAGTATCGAAGAGCGATGCATGACGCTGAGACCGCCTTTTACCGGGAGATCGCTGAAGGGGGAAACCATGACCCGTGGGGACTAGCGTATCGGACGGCGAGTGGTAGGCGACGCGCACCAACTAATGTGGTTAACGGGGTGGAGTATGCGGGGCGGTGCTCGGATGATGTGAGTGGGGCCATGCGCACCTTGATGTGGGCGCTGTGTCCGGATGACTATATGTCTCGGGACACTCCGTACCATGCGCGGGTGCGTATCATGGCCGCGCTCCCCCCATCCGGGCGGGACGCAGACCCGCTGAGCAAAGACTCCCTTCGTGCCATAATTGGCTCACTGAAGAATACCGCACCGGGCATCGACGGTTTAACGGCGCGCATTATCAAAAAGGCACTTCCGGCTGCTGAGGCCGAGTTCGTGGCCGTATACGCACGCACGGCTGCTTTGCCGGTGTTGGCGGGCGTCCTGCCGGCGGACCTGGAGGTGACTCGTGCTGGACGGAGGATGCGGGAGTGCGAAGGATTGGCGCGGGAGTTGGCGGCGGAGAGACGACGGCGGATCGACGGCGATGTCTTGGTAGTTTGGCAGGACAGGTGGGCGTCTGAGGGTAAGGGGAGGGAACTGTACAAGTTCTTTCCCGATGTTGCGGACAGGAAGAAGGCAACGTGGATGGAGCCGGACTATCAGACCTCGCAGATCCTCACGGGACATGGGATCTTCAATAAGCGATTGGCGGATATGCGACTGAGGGAGGGGCATGCTTGCGACTGCGGGGCGGTTGAGGAGGACAGGGACCATGTCCTGTGGGAGTGTCCTCTCTATGACGAAATCCGGGGCAGGATGCTCGATGGAATCTCGCGGTCTGAGGTGGGCCCAGTTTACCACGCGGACCTGGTCAGGGACGAGAAAAATTTTCGGCTCTTGCGCGAGTTCGCGCATACATGGCACACGGCGCGCACTGCGCGCGAATTACGAGGACTGCCTGGCGACGAAGAATGTGGGTGA
Protein
MSEEERGLFSPRVSLARSPPRGLTAPLPAPMPPPAPRGVRAGAAVSAKGRRTGLHIPVASGLSSSAPVTPVDPEAGVPSFPIPVASGAPTGPLDVAAQGRLELLERANRAVRGIMSVATAASKLNKSEVNLISELGRDILAVVGALGIQLSDKELVVERLRSAEASARRDSVAPSMAAGAAAGSGTGPATFATVLRTGPGGVPRSIGASQGPSLAFYPSEGNAELKTAEDTKKEVKKAIDPKSMAIGIQSVRKVGNAGVVVQTTSPAAAVKLRNAAPPSLRVTEPRRRQPLVAVNGVEGDPSFEEVIECLASQNLDPEEWPLTRVRAELTGAFKKGRRQSNNTTVVFNASPRIRDALVKIGRVYVGWVACEVTDFVRVTCCNKCQQYGHPEKFCRAKEATCGRCGEDGHRMEALHIGGWDLYMVSAYFQYSDPIDPYLHRLGNILDRLRGARVVICADTNAHSPLWHSLPRHYVGRGQEVADRRAKMEDFIGARRLVVHNADGHLPTFSTANGESYVDVTLSTRGVRVSEWRVTNESSSDHRLIVFGVGGDTTGERNEDEEARSDLRPDEPCALRRYRDRGVDWDLFRSRIHERMGSLDLEEPVAALCEKFTGVITRTAAECLGSLKADRTDRGYEWWTPVLDKLRVAQGRARRRWQKARRTGGEEEEQSGRVFRDRRREYRRAMHDAETAFYREIAEGGNHDPWGLAYRTASGRRRAPTNVVNGVEYAGRCSDDVSGAMRTLMWALCPDDYMSRDTPYHARVRIMAALPPSGRDADPLSKDSLRAIIGSLKNTAPGIDGLTARIIKKALPAAEAEFVAVYARTAALPVLAGVLPADLEVTRAGRRMRECEGLARELAAERRRRIDGDVLVVWQDRWASEGKGRELYKFFPDVADRKKATWMEPDYQTSQILTGHGIFNKRLADMRLREGHACDCGAVEEDRDHVLWECPLYDEIRGRMLDGISRSEVGPVYHADLVRDEKNFRLLREFAHTWHTARTARELRGLPGDEECG

Summary

Uniprot
ProteinModelPortal
PDB
2EI9     E-value=6.0342e-81,     Score=770

Ontologies

Topology

Length:
1012
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03967
Exp number, first 60 AAs:
9e-05
Total prob of N-in:
0.00049
outside
1  -  1012
 
 

Population Genetic Test Statistics

Pi
1.137605
Theta
0.968781
Tajima's D
0
CLR
0.800234
CSRT
0.434578271086446
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号