SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00746
Annotation
hypothetical_protein_RR46_00776_[Papilio_xuthus]
Location in the cell
Nuclear   Reliability : 2.338
 

Sequence

CDS
ATGGTTAAAGTGATGGACAAGAATGGACGTTGTCACAACGCCCGGGCTCTGCTGGACAACGGCAGTACTTCTAACTTCGTGACCTCCGACCTCTGCGAGAAACTAGGTCTGCCGCGTCATAACACAAACTCAACTGTCATCGGAATCAACAGTAAACTTTCATCTAGTACTAAAATGTGTACATTGTCACTACAAGCTTGTAATGGCAGCTATAAGGCGAGCGTCGATTGCTATATATTGCCAAATATCACTACATCATTGCCTTCAACATTTATATACAAAGAACACATACCCATACCTACCGGAATCGAACTAGCCGACCCCTCTTTTAACGTTCCTTCGGCTATTGATATACTAGTCGGGGCTAGCATCTTTTGGAACATTTTAGGATCAAACACAATAAGCCTAGGTAAACATCAACCCACTTTACGTGAATCCAAACTAGGATGGATTGTGTCTGGCAGTGTTCTTCAACATTCCTCTTATAAAAATACTCACACGCATTGCCACTTCACTCAATCTCTTGAATCTCAGCTTAGTCGGTTCTGGGAGTTAGACTCAGTCTCTTCTAGTCATTCTTTGTCTAAGGAAGAACGAGAATGCGAGGCAATCTTTAGAGAGACAACAAGACGAAATAAAAAAGGTGAGTTTATAGTTACTATTCCTCTTAAACAGTCTCCTGACGTTCTGGGATATTCATACACAAAAGCAAAATTAAGATTTCTTTCTGTAGAGAGAAAATTACAGCGCGATGAGAAACTGAAGAATGATTATCATAATTTTATGCCAGCGACGTCCTCCGGTAAGTCGTTTAATGACATACAGCACATTGGCCCTACAGTACAAGACGATCTTCTTTCCATCCTGCTGCGATTCAGGCAACACAAATATGTGGTTACCAGCGATGTGGAGAAAATGTATCGGGCTATACAAGTAGAACCTTCTCAACGTAGTTTACAGCAAATATTATTTAGATTTGATCCGTCAGAACCGTTGCATACTTACATTCTGAACACTGTAACATACGGAACGGCATCCGCTCCCTTCTTAGCTACTCGATGTTTAATTGCTCTTGCTGATGAATGCACAGACCCAGAGACTAAACGAGCAATAGCACATGACTTTTATATGGATGACTATTTGGGAGGGGGTAATTCAATTGAAATGGTAACAAAACTTTGTCGTAATATTATCAATACACTAGACTCAGCAAAATTTAACTTACGTAAATGGCGATCTAATAGTACAAAAATATTGCAAACAATTTCTGATATTAAGGCAGATAAAGATAAGACGTTAAATTTGAATAACTCTGCGCCGAGCAAAACTCTTGGTCTTCACTGGAACTCTGAATCAGATAACTTCTTCTTTTTGTTAAATTCACATCAGACCTTTAAAGTCACTAAACGCACAATCTTGTCAGAAATTAGTCAGGTTTTCGATCCTTTGGGGCTCGTCGGACCATGCATTGTTGAAGTCAAATTAATAATACAACAGTTATGGAAAACCAAGTCCGACTGGGATGAAGAAGTTCCAATCAACTTAAAAACATCATATTTGAGCTTAATGCAATCACTTCCATCACTTAATAATATAAATATTCCTCGATGGTCCTTTAACGACGACACTGTTACCATCGAAATTCATACGTTCTCAGACGCATCAGAACGCGCTTACGGAGCGAGTTGTTATATTAAAACTATTACAAGTAATGGCAATATTCGCGTTCGCCTTTTAGCTTCTAAGAATAAGATTGCACCCATTAAGTCAAGTACAATACCTCGTCTTGAATTATGCGCGGCCTTATTAGTGAAAGCGTTGCATTTGGAGATCGTCTCGGATCTTACCAAGGAGGGCTTCCTTAGCGCACTCGATCGCTTCATTGCCCGTCGAGGGAAACCGCAGAATATTTACTGTGATAATGGAACTTCGTTCGTTGGAGCCTCCAACTATTTAATTCATAATTGTGTTGATGACATCAACAGTCTAGATCCATCTGACTTAACCTTCCTTACGCCCGCCCATTTCCTTATTGGTCGGCCACTCACTTCGGTACCATATCCCGACATCACGGAAGCCAACATCACTCGTCTTCAACGTTTCCAACGAGTTGAAAGCCTAAAGCAACATTTTTGGAGACGATACTCTAATGAATATGTTTCTCTCTTACAACAGAGATACAAATGGAAAAAATCTTCAGGTCAACTGCGGATCGGTGCAATGGTCATTATCAAGGACAAGACATTGCCGCCAATGATGTGGCTTTTGGGACGAATAGTTCGTCTCGTACATGGCAACGACGGCATCGCCAGGGTTGCTGATATTGCAACCACGAAAGGCATACTACGCCGGGCATACAACAACATATGCCCGCTTCCTGTAGACTCCTCGAAGATCCATATTGAAGAAGACGACTCTTCAACGCCGGGGAGGATGTCCGCGCCAGTACTTCACGTACAAGCGGGGACTACGAGGTCTGCGGGGGGGTCCAACCACCACCACGGCATCGACGACTCGAGCGGCGAGGACCGAACACACACAGCGACACAGAACACTACTGGAACGATATAG
Protein
MVKVMDKNGRCHNARALLDNGSTSNFVTSDLCEKLGLPRHNTNSTVIGINSKLSSSTKMCTLSLQACNGSYKASVDCYILPNITTSLPSTFIYKEHIPIPTGIELADPSFNVPSAIDILVGASIFWNILGSNTISLGKHQPTLRESKLGWIVSGSVLQHSSYKNTHTHCHFTQSLESQLSRFWELDSVSSSHSLSKEERECEAIFRETTRRNKKGEFIVTIPLKQSPDVLGYSYTKAKLRFLSVERKLQRDEKLKNDYHNFMPATSSGKSFNDIQHIGPTVQDDLLSILLRFRQHKYVVTSDVEKMYRAIQVEPSQRSLQQILFRFDPSEPLHTYILNTVTYGTASAPFLATRCLIALADECTDPETKRAIAHDFYMDDYLGGGNSIEMVTKLCRNIINTLDSAKFNLRKWRSNSTKILQTISDIKADKDKTLNLNNSAPSKTLGLHWNSESDNFFFLLNSHQTFKVTKRTILSEISQVFDPLGLVGPCIVEVKLIIQQLWKTKSDWDEEVPINLKTSYLSLMQSLPSLNNINIPRWSFNDDTVTIEIHTFSDASERAYGASCYIKTITSNGNIRVRLLASKNKIAPIKSSTIPRLELCAALLVKALHLEIVSDLTKEGFLSALDRFIARRGKPQNIYCDNGTSFVGASNYLIHNCVDDINSLDPSDLTFLTPAHFLIGRPLTSVPYPDITEANITRLQRFQRVESLKQHFWRRYSNEYVSLLQQRYKWKKSSGQLRIGAMVIIKDKTLPPMMWLLGRIVRLVHGNDGIARVADIATTKGILRRAYNNICPLPVDSSKIHIEEDDSSTPGRMSAPVLHVQAGTTRSAGGSNHHHGIDDSSGEDRTHTATQNTTGTI

Summary

EMBL
KQ459312    KPJ01687.1    KQ460205    KPJ16960.1    ODYU01009575    SOQ54097.1    + More
NWSH01001014    PCG73111.1    KQ460500    KPJ14270.1    NWSH01001945    PCG69607.1    KQ460970    KPJ10166.1    KQ460545    KPJ14069.1    GGMR01010750    MBY23369.1    KQ458793    KPJ04955.1    KQ460211    KPJ16510.1    GAMC01020552    JAB86003.1    GALX01003264    JAB65202.1    GEZM01066274    JAV68017.1    GEZM01066272    JAV68024.1    GGMR01002219    MBY14838.1    NWSH01006923    PCG63186.1    GGMR01014230    MBY26849.1    GBBI01004211    JAC14501.1    GGMR01018506    MBY31125.1    GALX01003263    JAB65203.1    NWSH01001201    PCG72150.1    ABLF02022040    ABLF02056888    JXUM01113346    KQ565681    KXJ70776.1    GGMR01014413    MBY27032.1    GEZM01021505    JAV88969.1    GGMR01013586    MBY26205.1    LBMM01003740    KMQ93188.1    GGMR01005535    MBY18154.1    GEZM01018629    GEZM01018623    JAV90127.1    GGMS01016389    MBY85592.1    GDUN01000088    JAN95831.1    GDUN01000087    JAN95832.1    GGMR01017408    MBY30027.1    ABLF02041599    GGMS01010815    MBY80018.1    GBBI01004139    JAC14573.1    ABLF02042264    GBBI01004140    JAC14572.1    ABLF02016109    ABLF02016113    ABLF02003232    ABLF02003233    ABLF02022909    ABLF02042631    GEZM01012999    JAV92824.1    ABLF02004142    GGMR01020500    MBY33119.1    GGFK01004538    MBW37859.1    GGMS01005792    MBY74995.1    GGFK01004563    MBW37884.1    ABLF02028302    ABLF02041631    ABLF02022912    ABLF02038819    ABLF02051942    ABLF02060282    ABLF02021176    ABLF02066403    GGMR01000448    MBY13067.1    GGFK01004613    MBW37934.1    GEHC01000870    JAV46775.1    GGMR01015704    MBY28323.1    GFTR01008874    JAW07552.1    GGMR01002340    MBY14959.1    ABLF02007122    ABLF02033517    ABLF02042806    AAZX01023505    GGMR01020322    MBY32941.1    ABLF02023723    GGMR01012316    MBY24935.1    ABLF02041590    GGMR01011015    MBY23634.1    ABLF02026305    GEHC01000869    JAV46776.1    GEHC01000865    JAV46780.1    GGFL01005358    MBW69536.1    GGMS01010200    MBY79403.1    ABLF02014076    ABLF02018588    ABLF02018590    ABLF02042430    ABLF02042408    ABLF02022815    GGMR01017803    MBY30422.1    LNIX01000036    OXA39969.1    GGFL01004049    MBW68227.1    ABLF02011447    ABLF02011449    ABLF02058523    GEHC01000894    JAV46751.1    GGMS01006802    MBY76005.1    ABLF02041731    ABLF02023842    ABLF02028949    ABLF02058391    GEHC01000939    JAV46706.1    GEHC01000877    JAV46768.1    GGMS01004301    MBY73504.1    GEHC01000864    JAV46781.1    ABLF02015610    ABLF02015611    ABLF02026843    ABLF02057498    ABLF02060119    ABLF02062416    ABLF02064495    AY180917    AAN87269.1    ABLF02016099    GEHC01000898    JAV46747.1    KQ973442    KXZ75531.1    AAZX01023184    DNYX01000039    HBK82233.1   
Pfam
PF05380   Peptidase_A17        + More
PF18701   DUF5641
PF03564   DUF1759
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF07679   I-set
PF05485   THAP
PF12259   Baculo_F
Interpro
IPR001584   Integrase_cat-core        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001878   Znf_CCHC       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR000477   RT_dom       
IPR001606   ARID_dom       
IPR001969   Aspartic_peptidase_AS       
IPR003598   Ig_sub2       
IPR036179   Ig-like_dom_sf       
IPR013098   Ig_I-set       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
IPR013783   Ig-like_fold       
IPR013087   Znf_C2H2_type       
IPR006612   THAP_Znf       
IPR022048   Envelope_fusion-like       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF48726   SSF48726       
Gene 3D

Ontologies

Topology

Length:
856
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.18547
Exp number, first 60 AAs:
1e-05
Total prob of N-in:
0.00888
outside
1  -  856
 
 

Population Genetic Test Statistics

Pi
398.375485
Theta
209.416195
Tajima's D
3.109087
CLR
0.096071
CSRT
0.982100894955252
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号