SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00743
Annotation
Retrovirus-related_Pol_polyprotein_from_transposon_17.6_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 2.818
 

Sequence

CDS
ATGCCGCCGCGAAAAATACGCCAACAGACGGATGACAATAGTGATTCTGGTGATGAAAAGGTGGACGCAGTGCCCTCGCCAGCACCAGTGCTCATGTCCGGGGATCAGCTGTCCTCGCTCCTGGCCGCCTTCTCAAAGTCGCAGGCCGAGGCGAACCGACAACTCGTCGAGTCCCTGTGGGCATCGCATGGTTTGGGAAGTGGATCGAAGTTCACCACCCCGATAGTGTCACCGTCCCCGACGCCAACAAGTAACATGGCTAAATGCACCGCGCGTTTTGATGGCGTCGCTCGCGATCCGGAGGCCGTTGAAGCGTTTATCGACTCTGTGGAGGTGTACAAGGAGTGTGCGTGCGTCTCCGACGATATCGCATTGCGTGGACTACCAATGCTCATGGAAGGCGAAGCAGCCATATGGTGGAGAGGGGTCCGGAACGAAGTGTCCTCGTGGCCCGACGCTCTCAAAAGGTTACGAGCTATGTATGGTGTGCCACGCCCTGCACATAAAGTTTTTCGTGACGTGTTTTCGTCTGAGCAAGGTGATGAGCTTGCTGACAGTTTCATAGTGAGGATACGTGCTATGCTGTCCAGATTGCCGTACCAGCTACCAGAGGAAGCCAGGTTAGACATAATCTATGGTCTACTTCATAAACGGATAAGGAAAAGACTACCGAGAGATGGTGTGAGCGACATAGAAACACTCATAGAGAAGTCGCGCATGGTGGAGGAGTCACTTGTGGAGTGCACGGCTGCCCCCAACATTCCGCCGCAGCCACACAAGTCGTTACCTACGGTGTTCGGCGAACGCAGCTCCGCGCCTGACGTGACAAGTGTGAGATCGCCGAGACCTGCCGGCGCCGCCGCTGCGCTAGTGCGCTCCTCCGTTGCTGTTGCACCGTCGTCGCTACCTCAACCGTCCCCATCCCCGCGTAGTGTAAAAAGCGAAACATTGGTTAAAAAGCTATTTTGTGTGTATTGCAAATCGCGTGGACATGTCCGTGATTCTTGTAACAAAATTAGTGAAAACAAATCTGTATCTTGTTATGGTTGTGGTGAAAAAGGTTTTATTAAAAGTAACTGTCCAAAATGTAACAATATTCCTAGCAATATTCAGAGTAATGTTATTAATAGAAACTCGCACGTTAAGGACAATGTATTCTATTCTGTAAATGTAAACACTTTCTCAGATTCACATTGTAATGATAAACATTCTGTCAAAAGGGGGAGTGTGTAA
Protein
MPPRKIRQQTDDNSDSGDEKVDAVPSPAPVLMSGDQLSSLLAAFSKSQAEANRQLVESLWASHGLGSGSKFTTPIVSPSPTPTSNMAKCTARFDGVARDPEAVEAFIDSVEVYKECACVSDDIALRGLPMLMEGEAAIWWRGVRNEVSSWPDALKRLRAMYGVPRPAHKVFRDVFSSEQGDELADSFIVRIRAMLSRLPYQLPEEARLDIIYGLLHKRIRKRLPRDGVSDIETLIEKSRMVEESLVECTAAPNIPPQPHKSLPTVFGERSSAPDVTSVRSPRPAGAAAALVRSSVAVAPSSLPQPSPSPRSVKSETLVKKLFCVYCKSRGHVRDSCNKISENKSVSCYGCGEKGFIKSNCPKCNNIPSNIQSNVINRNSHVKDNVFYSVNVNTFSDSHCNDKHSVKRGSV

Summary

Pfam
PF00077   RVP        + More
PF00665   rve
PF17921   Integrase_H2C2
PF00078   RVT_1
PF17917   RT_RNaseH
Interpro
IPR018061   Retropepsins        + More
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR001969   Aspartic_peptidase_AS       
IPR036875   Znf_CCHC_sf       
IPR000477   RT_dom       
IPR041373   RT_RNaseH       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
6GSE     E-value=0.0825897,     Score=84

Ontologies

Topology

Length:
410
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00209
Exp number, first 60 AAs:
0.00047
Total prob of N-in:
0.02756
outside
1  -  410
 
 

Population Genetic Test Statistics

Pi
281.515215
Theta
195.221365
Tajima's D
2.698944
CLR
0.22271
CSRT
0.96115194240288
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号