SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00672
Pre Gene Modal
BGIBMGA002210
Annotation
PREDICTED:_uncharacterized_protein_LOC106661425_isoform_X1_[Cimex_lectularius]
Location in the cell
Nuclear   Reliability : 4.023
 

Sequence

CDS
ATGGAAATTTTACAACCAGCCGAGAATGAATTCATTGAAAATGAAGACAATATCAACATGTCTGAAGAGTCAACATCGGAGCCAAATTCTAGCCTGCCATACCGTAGCTATCAAACTCATAAATCAGCACATAAGCTATTTAAAAAAAAGATCCTACAGAATTCCTTTGGTCACGCCTGTAATGTTTGTGATCGTTTATGGTTTTTAGAAGATCTTAAATGTGGATCAGCAGATGAAGAAATCTTACTTAAACGAATTACGAATTTTACGGATGTCACTCAAGTCATGATGTGCAAAACTTGCAGAGCCAGTATCTTAAAAGGCAATATTCCCTTTTTAGCTACGTATAATGGTTTTAAATATCCACAAAGACCAGTGGATTTGCCGGAATTGGATATTATTGCTGAGAGACTTATTTCACCAAGGCTTCCGTTTATGCAAATACGTAGATTACGCCATTTCAATGGTCAATTTGCTATAACTGGCCAAATAATTAATGTGCCTGTCTCGGTTGATAATATGATAAAACTTTTACCAAGGCCGCTTGATGGAAATGAAGAAGACTATTGTATTAATGTTCATATTAAGAAGAAACTTATTCATAAAACAAGTTACCTTCACGGATTGGTTAAAGGTATTGTCATTAAAAAATGGTTGACGTATTTAATTGAAACACCTCTGTATAAGCACTTCCAAATTAAAGTGGATGATGCTTGGTTTACATCCAATGGTGAGAAAGTCATAATTGATTACACGGATACAGGAGGATCGAGTAGACAAGATGATGTGCAAGAGCTTCCATCCTCTGAAACAGCAAATCACACTCACTCTGTGGATTCTGACTCCATAGAAAAACGAATACACATCGATGATTTAAGTGAACATATTGTGATTGATGAAAGTCTGACTGCGCAACAGCAAACTCTCATGTGGAGTGAGGATAAATTTTTACAAATTGCTCCAGGTGAAAATAAAGTTCCAGAGAGTTTGTTATTTGACACATATGCAGAGGAATTATCATTTCCAGCCATTTACCTTGGGGAATTTCGTGTATTTCGAGAAGAAGCCAATGTAACGCCATTCATGATGGCAACAAGTGAATTACGTCGTTCAGACAGGAGAGGAGTACTTCCTAATAAGCTTCTTTACACGGCAATGAAAATAATGCGCTTAAGAGTTTGCAGTGCTCTGAAGATTGGATTCAAACACATCGGTAAGGATACCAATATAAGTAAAGAACGCCTATTATCTGATGATTACATAAATGCCTGTTTGGAAACAAATTTAGCTTTTATGAAGTCAATCCCTAATTCTGCAACTTATTGGTCTGCGCGAAAGCGAGATCTTTTTGCAATGATGCGCCAGTTGGGTAGGCCAACTATGTTTTTGACCATAAGCGCGAATGAAATTGGATGGCCAAACCTTCTAAGGATTTTACACAAATTGAAAAATCAGGGAGAAGAGTTAACCGATGAGCAAATTGAAGTGTTGAATTATTTTCAAAAGACAACTCTGATTAATGATGATGCCGTCACCTGCGCAATATATTTCAATAAATTGATTAATGTAATCATGCTTATATTGCAGTCAAAGAAGTTGAGTCCATTTGGTAAATATCGAGTGAGTCATTATTTCAAGCGGATTGAATTTCAACATAGAGGTAGCCCACACGCCCATATACTATTATGGTTAGATAATTCACCAAAAGATGCATTGGGGAACGACTACGAAGAAGCGATTGCATTAATTAATTCGCTTATTTCAGTGGATTCATCTGAAGCTTCCGGTCACATCAAACTTCAAACTCATAAACACACCTTCACGTGTTATAAAAACACTCGTACAAATAATCGGCAATGTCGTTTTGAAGCACCTTTTATGCCTATTCGCCAAACTACTATTCTCATCCCGCTAGACAAGGAGAATCCAGAGTTACAAAGACTTAAATCGCGGTATAAAAATATACGACAAAACTTAGAAAGTAATGACTACGAAAATATTGAACATTTTTATCAAGACAATTGCATAATATCAGATGATGACTACGTTAACATTTTACGAGCTGGGATAACTCGGCCTCGAGTATTTTTAAAACGGAGACCTTCAGAAAAATGGCATAATTGTTTTAATCCTTTTATTTTGAACGTGGTTGGGTCTAATATGGACTTCCAATTTATCACCGAAGAATATTCATGTGCTCAGTACGTTGTCGACTACATAAATAAGACTAACAGAGGAATCAGTAACTTACAACAAAAACTCGTCGAAATTATGAATGATAATCCTGACTTCGACATTATTGCTGCTACAAAGAAACTTAGCGTCAACGCGCTGAATACAATTGAAATGTCAAGCCAGGAAGCAGCGTGGTTTCTTTTGCGTGAACCCATGTCTAAAGCGTCAGTAGCTATTGAATATATTCCAACATACTGGCCACAACAGCGAGAAAGAATTCGAAAAACATTAAAAGAATTAGCGCAACTTGAAGATGATGATACAAATGTATGGAAGGAAAATTGGTTCGACAAGTACGAGAAAAGACCTGCTATAATTAATGATATCACTCTAGCTCAGTTTGTTTCGCGATATACTGTCAATGCTGCCGGAAATGTTAAAGAACGAAAAGTCCCACAAGTTATAAGATTCCGAAATTATGATATGGGGAAAGAGTTAACAGAATACAAGAGGGAAATGGTTACGCTACATATGCCTTTCAGAATTGAAGAAACTGATGTTTTGAGTGATATGAAGTTTTTGCGCATCTATGATGAAAATGAAGATCTCATAATGGAGAGACGAAAAGAATTTGAATCTAATTTAGATATCGCAAAAACAATGGAAATTTGTGCACAATTATGTCGGGAAGAGACGGAGCTCAACGATGTGCAGGCAAATAACGATGACCAGAACAGGGCTAATGTCCAAGAAATTCTAGATCCATACCAACAGTTTCTTCAAGATCCAAACTCGGTTATTAACGATGATTTAGTATCAGCTTCAATGAATAAACTCGGAGCGATATGGAAAAAAAAAGACAACCTCATGGAGACTCCAGAGTTTCTTGAGCTCATGAGAAGAACTAACGAGAAGCAATTCGAGCTGGCTCAACACATAATATGGTTATTGACTTCAAAAAACCCAATGCCGTTACAACTATTTTTGACTGGTCCTGCTGGATGTGGGAAAACTTTTCTCATCAAACTGATTATGGAAATTTGTAATAGATTCACAGATACAGATGGCTACTGCAATGCTTATCTTGTATGTGCATCCACTGGAAAAGCTGCGGTTGCTATTGGAGAAGGGGAAGCGGAGCAACGTTGTCCTGGAGGAATTCGATTATTTAATGACAACCATTCAGTTGATGCGTACAACTTGAAAGTGTTGAGTTCATCTGATGAAATATCAAATTCAGTTGCTGATGATGAATTTTTGGGGTGTGAAAATGATCGCGAAAAGCAAAGAGTTGCTAGAGAAAAGTTGTACAAACTTAGTACAATTGACACGGGAGGATTACCTTATGAAATTATTTTTGCTCCAGATAAACCCTACATGATAACGACCAATATTGATGTTGCTGACGGATTAGCCAATGGAGCGGTAGGCAAATTGATCCATGTTGAATTAGGTGTTGATGATAGAATTTTAAGAGTTTGGCTTCATTTTCCTAACGGCGTCGGTGTTAAAGCTCGAGCAAAAACAGCTGGATATGCGAATTCAAAAGGAATTGATAATACAGCGGTTCCTATCAATCGTAGAACTGCAACAATTCCTCTCAACCGGAACAAATCAATTCATGTCAAAAGAAATCATTTTCCGTTAAAACCAGCTTGCTCCTTAACCATTCATAAATCTCAAGGTGGAACTTTTGATGAAATAGTTTACAAGTACAGCAAAGCTCACTCACAGTCTTTAGTTTACGTAGCTTTATCTAGGGTTACGAGTCAACAAGGACTTTACATTGTATCTAGTGAAGATCAACGTTTTCACCATGGCAGACGTGAAAATCAAGCGATGCTTTTGTTACGAAACGAGTTTACTCGGCTTTCTACTGTCCATCTTAATACAATCGATCGAGTTATACTCGAAAAGATTAATGAAGGGAATATCATTGTTTTTTCTCTAAACTGCCAAAGTCTCCGGGCACATGCATGTGATCTTCGTGGCAACATAATACGAAAATCACATGTTTTAATGTTATCAGAAACTTGGCTTTCTAACAACGAACAGGTTGAAGTTGGAAATTTTAATCTCATCACACAATATAGGCGACCAAACATAAAGCGTGGAGGAGGGGTCTGCATTTATCACAATACTGACGATTCACAGCGGGAGTGTGCGGTCAATAGTGATACTCAATTGAGAAGAGGTCCCCAGCACACAAGTCTAACTAAATCTGCTGTAGGAGATATATGCGCCGCAAGATACACTACATCCAGCGACTTTACAAAATCAAAGAAGCGCTTAAAAAAACGAGCTGTACCCAAACTGAACTTGACACTGCCACCATTGAGAGATGAAATTCTTCTTCAATTTTTGCAACTCAACTCGCAAGCAGATGTCACCCCACAAGGCCAGTTTGAGGTTCAGGCCGTTCCTAGTGCTTTGATGCCAGCATCCTCAAGTCAGCCTAGCGGTCTAGAGAAAACTGATGTCACCCCACAAGGCCAGTTTGAGGTTCAGGCTGTTCCTTGTACTTCAATGCCAACATCCTCAAGTCAGTCTAGCAGTCTAGAGAAAAACGTCACCAAAGGAAGCCAGCGGAAAGAAAGTGAAAGTCAAATAAGAAAAAGAAAATTAGAAGATGTTGATGTTACACCACGGAAAAGGAGGCTCTTAAGTGAATTGAGAAAAACAAAGTGCACATTGGCATCATTAAAAAAGAGCGCGAAACTAATAGACAATTTATCGTCAGAGTTTCTAAAAGAAATTGTCACGTCTGCGTTGATAAATCAAAAGCTCTTTGATGAAATAGCGTTAAAAGAAAGGTTAACTTATAGCAAAGCCACAGATAAAGTGGAAGGGTTTATCGATTATGGATATGAGAGGAAAGATGAGCTAGCAAATCATGCCTTAGTCTTCATGTTACAAGGACTTACCACCCCTCACAGCAAAAACTCCAATTGTGAAGAAGACAAAAAGGAACTCATGACGGATTTTCATGATTTAGTTTTTGGGTTTAAAGACGAAGATGATCAAGGTCAAGATATTAATGAGTCTCCTAGTCATGTTTCCACAGAAAATGAAAATGAGGAAGACAACCCGGTTCTCAGTATACCTGAAGAAGAAGAATATAAAGAAATAGTTTCCTCTTCCGTCCAAGCATCGGTCTCTGAGGGCTAA
Protein
MEILQPAENEFIENEDNINMSEESTSEPNSSLPYRSYQTHKSAHKLFKKKILQNSFGHACNVCDRLWFLEDLKCGSADEEILLKRITNFTDVTQVMMCKTCRASILKGNIPFLATYNGFKYPQRPVDLPELDIIAERLISPRLPFMQIRRLRHFNGQFAITGQIINVPVSVDNMIKLLPRPLDGNEEDYCINVHIKKKLIHKTSYLHGLVKGIVIKKWLTYLIETPLYKHFQIKVDDAWFTSNGEKVIIDYTDTGGSSRQDDVQELPSSETANHTHSVDSDSIEKRIHIDDLSEHIVIDESLTAQQQTLMWSEDKFLQIAPGENKVPESLLFDTYAEELSFPAIYLGEFRVFREEANVTPFMMATSELRRSDRRGVLPNKLLYTAMKIMRLRVCSALKIGFKHIGKDTNISKERLLSDDYINACLETNLAFMKSIPNSATYWSARKRDLFAMMRQLGRPTMFLTISANEIGWPNLLRILHKLKNQGEELTDEQIEVLNYFQKTTLINDDAVTCAIYFNKLINVIMLILQSKKLSPFGKYRVSHYFKRIEFQHRGSPHAHILLWLDNSPKDALGNDYEEAIALINSLISVDSSEASGHIKLQTHKHTFTCYKNTRTNNRQCRFEAPFMPIRQTTILIPLDKENPELQRLKSRYKNIRQNLESNDYENIEHFYQDNCIISDDDYVNILRAGITRPRVFLKRRPSEKWHNCFNPFILNVVGSNMDFQFITEEYSCAQYVVDYINKTNRGISNLQQKLVEIMNDNPDFDIIAATKKLSVNALNTIEMSSQEAAWFLLREPMSKASVAIEYIPTYWPQQRERIRKTLKELAQLEDDDTNVWKENWFDKYEKRPAIINDITLAQFVSRYTVNAAGNVKERKVPQVIRFRNYDMGKELTEYKREMVTLHMPFRIEETDVLSDMKFLRIYDENEDLIMERRKEFESNLDIAKTMEICAQLCREETELNDVQANNDDQNRANVQEILDPYQQFLQDPNSVINDDLVSASMNKLGAIWKKKDNLMETPEFLELMRRTNEKQFELAQHIIWLLTSKNPMPLQLFLTGPAGCGKTFLIKLIMEICNRFTDTDGYCNAYLVCASTGKAAVAIGEGEAEQRCPGGIRLFNDNHSVDAYNLKVLSSSDEISNSVADDEFLGCENDREKQRVAREKLYKLSTIDTGGLPYEIIFAPDKPYMITTNIDVADGLANGAVGKLIHVELGVDDRILRVWLHFPNGVGVKARAKTAGYANSKGIDNTAVPINRRTATIPLNRNKSIHVKRNHFPLKPACSLTIHKSQGGTFDEIVYKYSKAHSQSLVYVALSRVTSQQGLYIVSSEDQRFHHGRRENQAMLLLRNEFTRLSTVHLNTIDRVILEKINEGNIIVFSLNCQSLRAHACDLRGNIIRKSHVLMLSETWLSNNEQVEVGNFNLITQYRRPNIKRGGGVCIYHNTDDSQRECAVNSDTQLRRGPQHTSLTKSAVGDICAARYTTSSDFTKSKKRLKKRAVPKLNLTLPPLRDEILLQFLQLNSQADVTPQGQFEVQAVPSALMPASSSQPSGLEKTDVTPQGQFEVQAVPCTSMPTSSSQSSSLEKNVTKGSQRKESESQIRKRKLEDVDVTPRKRRLLSELRKTKCTLASLKKSAKLIDNLSSEFLKEIVTSALINQKLFDEIALKERLTYSKATDKVEGFIDYGYERKDELANHALVFMLQGLTTPHSKNSNCEEDKKELMTDFHDLVFGFKDEDDQGQDINESPSHVSTENENEEDNPVLSIPEEEEYKEIVSSSVQASVSEG

Summary

Uniprot
ProteinModelPortal
PDB
5O6E     E-value=0.000481899,     Score=109

Ontologies

GO

Topology

Length:
1780
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04385
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00122
outside
1  -  1780
 
 

Population Genetic Test Statistics

Pi
316.640907
Theta
210.172671
Tajima's D
1.592036
CLR
0.054338
CSRT
0.811859407029649
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号