SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00668
Pre Gene Modal
BGIBMGA010114
Annotation
PREDICTED:_uncharacterized_protein_LOC105842017_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.65
 

Sequence

CDS
ATGGAAGCAGTGCGTGGCGTGCCCGTGCTCACTGTGCTCACCGACACTCACACGACGCTACTACAGACCGTCCTGTGTGCTCAGCCACAAGGTAATGTATTTAATCAGAGCCGAATCACAAAGCGCATCCGCACCCTTTCTCAGCGAGCGCCGCCGGCACACCTGCAACGGTCGACGGCAGGCGGCTTGGATCACAGAGGGCGTCGGCACCCTTTGATGACTCGGATCACCGGCATATTTGCAACGATCAACGGCAGGCGGCTTGAATCACAGAGCGCACCGGCACCCTTTAACGGCTCCGGTCACCGGTACACTTGCAACGTTTGTGGCGATCGGCTTGGAACACACACCGCAGCGGCACCCTTTGATGGTGCGGGTCGCCGGCACACTTCAACGTTCGCGGCGGGCGGCTTGGATCACATACCGCAGCGGCACCCTTTGATGGCGCGAGTTGCCGGCACACTGGCTGACTATAAAAAGAGCTGCTACGCATTTAAAACCACGATGAACGATATGATGACTCAACTGTCTTACGATCATCGCGTAACCTTGACTGAAATGAACGGCACCATGAAATCAGAAGAAAATACGCGAGTGCGCATTGCCGACGTTTATTTTCCTACATATGACCCCGATTCTAGTACCGATGTACACGATTGGGTAGATCTTATTACACGTACTCAAGCAGAATATGGACTTCGAGATCATGAGGTACGATTAAAAGCAGCAAGTGTATTAAAAGGTCGTGCAAAGACATGGGCAGATAGTAGCCTCCTAAGGACAACAACCTGGACGGAAATGCGGGATGACATGTTGCAAACTTTCGAACCCGAATCCAGGTACTTTGCAGATATTCTGAGTTATAGAAATTACACCATTGACGAGGCAGAAAACATTCAAGATTTTATTTCAAACGTGTGGCGTATGTTCAAAAGGATAGTAAAACCTCATCCAACGGAACAGGATGCAGTAGAATTTGTCATTGGGAGCATTGGAGATGAACGGATTCGGACAGAACTGCTCAATAGCAAGTCAAATACTGTTCCGGAGTTAATTGCTATAGCCAAAACGTTTCGCAAACGAAAGAATATACCAACTAAACCGACTGAGTTCAGTAAGCAACCTCGTTTGAACTTTAATCGTGATAGATCCAACTTGACTTGTCATGTTTGTGGAAAAACAGGTCATTTTGCTGGATATTGCCCGGAAAATGCAATTCGACGTGGAACGTTTTCAGCATCAGGATCAGGAGCTTCTTTCTCATCAAGAGATTCGCCTGTACCATCCATTAAGGAGTGTTCCTACTGTAAAGGGACTCGACACACTACAGAAAGATGTTTTAAAAGAATTGCTGACGAACAACACAGAACGAAATGGATATGGACTGCCTCTCACGAAGTAACAAGATTAAACATAATCGATTACCGTACCTGCGCGCTGCTTCATACCATGTTCAAAGAGGGCGTACCAATTGAACTTCATACAGATGCAAGTGATGCTGATCCAACTATCACTCATATGAATTGGAGACTGTGGCTGTTAGACGAAGTTTTGTGCCAAAAAGTTAAGCTGGAGAATGGAAGAACTAAGACTCTAAAAGCGGTACCACAATGCTACCAATGGAGTATCATAAATAATTACCACAAAGTTTTAAAACACTTTGGCTGGGAGAAAGCACTCGAAAAACTCAAAGAACACTTTTGGTCTGACAAATTGAGCTCAAAAGTTCGCAGCTTCATAGACAATTGCGTGTACGGCATTGAACTGCACCACATCGTAGCATACACGAATAGATCAAACGGCCAGGCCAAAAGAATTTTCCGCATCGTTAAAGATGGACTCACTGTCATTAGTAATATTCAGCAGGATCACTGGGAACACAACTTGCTATTAACTGTACAGTACCTATCCAAAGCAACTGGGAAAGCACCTATGGAATGGAGCTAA
Protein
MEAVRGVPVLTVLTDTHTTLLQTVLCAQPQGNVFNQSRITKRIRTLSQRAPPAHLQRSTAGGLDHRGRRHPLMTRITGIFATINGRRLESQSAPAPFNGSGHRYTCNVCGDRLGTHTAAAPFDGAGRRHTSTFAAGGLDHIPQRHPLMARVAGTLADYKKSCYAFKTTMNDMMTQLSYDHRVTLTEMNGTMKSEENTRVRIADVYFPTYDPDSSTDVHDWVDLITRTQAEYGLRDHEVRLKAASVLKGRAKTWADSSLLRTTTWTEMRDDMLQTFEPESRYFADILSYRNYTIDEAENIQDFISNVWRMFKRIVKPHPTEQDAVEFVIGSIGDERIRTELLNSKSNTVPELIAIAKTFRKRKNIPTKPTEFSKQPRLNFNRDRSNLTCHVCGKTGHFAGYCPENAIRRGTFSASGSGASFSSRDSPVPSIKECSYCKGTRHTTERCFKRIADEQHRTKWIWTASHEVTRLNIIDYRTCALLHTMFKEGVPIELHTDASDADPTITHMNWRLWLLDEVLCQKVKLENGRTKTLKAVPQCYQWSIINNYHKVLKHFGWEKALEKLKEHFWSDKLSSKVRSFIDNCVYGIELHHIVAYTNRSNGQAKRIFRIVKDGLTVISNIQQDHWEHNLLLTVQYLSKATGKAPMEWS

Summary

Pfam
PF17921   Integrase_H2C2
Interpro
IPR036397   RNaseH_sf        + More
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR001995   Peptidase_A2_cat       
IPR001584   Integrase_cat-core       
IPR001969   Aspartic_peptidase_AS       
SUPFAM
SSF50630   SSF50630        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D
ProteinModelPortal

Ontologies

Topology

Length:
648
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01065
Exp number, first 60 AAs:
0.00926
Total prob of N-in:
0.00059
outside
1  -  648
 
 

Population Genetic Test Statistics

Pi
326.854741
Theta
176.630569
Tajima's D
3.483789
CLR
0.108498
CSRT
0.993100344982751
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号