SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00667
Pre Gene Modal
BGIBMGA014468
Annotation
non-LTR_retrotransposon_CATS_[Danaus_plexippus]
Location in the cell
Extracellular   Reliability : 2.679
 

Sequence

CDS
ATGACGGACAGTACTCTGGTCACTCGCGTATTCACTGACGGAAGTAAGCAGGACGATGGATCAGTTGGAGCCGCATTCGTGCTTTACAGACCCGGCGACACTGAAACATCCGTAACAAAAAAGTACAAATTACACAGTAGCTGCACAGTCTTCCAGGCAGAGCTGTACGCCATCTGGAAAGCCTGTCAGTGGATTGTAAGCGAAAATCATCCCCACACATACATCTTCACCGATTCTCTCTCATCAATATACGCGATAAATAACAGAAGCAACACACACCCCATCATAGTGAACATACACAAACTCATACACGCTAACCACACTACACACAAAATTTTCATAGACTGGGTAAAGGGACACTCGGGTGTCATAGGAAACGAGGAAGCCGATGCGGCTGCCAACAGCGGCGCACGCATGCACAAGGCCCCCGACTACTCGCAGTTCTCAATATCCTACGTGAAACACAAGATTCACACAGAACACCACGCCATCTGGCAAGCCAGATACGAAAGCTCCCCGCAGGGCTCACACACAAAAACACTACTACCAAAACTGAACGACATCAAAGAACTCAACAAATGCACACAAACAAACTTTCAGCTTACACAAATACTCACAGGCCATGGATATCACAAGACATACTTACATCGCTTCAAAATAGCACCAGATGACACCTGCCCCTGCGACGGCACTTCCAGCCAAACTGTAGAACACCTCCTTAAAAACTGCCAAGTGTTCGCTGCGAAAAGGCACAGCCACGAAGAAACGTGCCACGAAGTACAGGTGTCACCATATAATTTACCTGAAATGTTAAAAAAGAAAGCTGCAATCAACTCTTTCACTTCGTTTTGCCAAACAATAATCAACAACATCAAGAAAATAAATGAAAACAATTAG
Protein
MTDSTLVTRVFTDGSKQDDGSVGAAFVLYRPGDTETSVTKKYKLHSSCTVFQAELYAIWKACQWIVSENHPHTYIFTDSLSSIYAINNRSNTHPIIVNIHKLIHANHTTHKIFIDWVKGHSGVIGNEEADAAANSGARMHKAPDYSQFSISYVKHKIHTEHHAIWQARYESSPQGSHTKTLLPKLNDIKELNKCTQTNFQLTQILTGHGYHKTYLHRFKIAPDDTCPCDGTSSQTVEHLLKNCQVFAAKRHSHEETCHEVQVSPYNLPEMLKKKAAINSFTSFCQTIINNIKKINENN

Summary

EMBL
JTDY01004660    KOB67904.1    JTDY01002407    KOB71471.1    KZ149985    PZC75691.1    + More
JTDY01003675    KOB69169.1    AB046668    BAB21511.1    AB211537    BAE44464.1    NWSH01001820    PCG70022.1    D38414    BAA07467.1    GBRD01013107    JAG52719.1    JTDY01000474    KOB77015.1    GFAH01000444    JAV47945.1    GFTR01004219    JAW12207.1    KP771712    AKU04650.1    IAAA01038678    LAA08500.1    GBRD01013108    JAG52718.1    KK120149    KFM77633.1    GFTR01004280    JAW12146.1    GDHC01002702    JAQ15927.1    GFTR01008639    JAW07787.1    KK114278    KFM62077.1    PYGN01001848    PSN32539.1    KK121445    KFM80483.1    KP771711    AKU04648.1    KK119855    KFM76920.1    GFTR01003820    JAW12606.1    GEGO01004274    JAR91130.1    IACF01001650    LAB67339.1    KK114580    KFM62817.1    AF015489    AAB94030.1    PYGN01000313    PSN48706.1    AF015813    AAB94039.1    KK119281    KFM75280.1    GEFM01006389    JAP69407.1    GEBQ01026019    JAT13958.1    GFTR01004599    JAW11827.1    GDAI01000743    JAI16860.1    IACF01003659    LAB69270.1    KK115566    KFM65430.1    GEBQ01009291    GEBQ01001010    JAT30686.1    JAT38967.1    GBBI01004507    JAC14205.1    GEBQ01028566    JAT11411.1    GG671513    EER18870.1    KU543676    AMS38357.1    PABS01000003    MAT33547.1    GBHO01026176    JAG17428.1    GBBI01004582    JAC14130.1    PYGN01000254    PSN49993.1    IACF01004097    LAB69692.1    KK114163    KFM61799.1    KK121687    KFM81025.1    GEZM01058723    JAV71702.1    GECZ01013919    JAS55850.1    IACF01002963    LAB68595.1    GBBI01004433    JAC14279.1    LBMM01027406    KMQ82197.1    JATN01000322    EUC56479.1    CAFZ01000607    CCA76093.1    GBBI01004351    JAC14361.1    LWDF01000042    OAJ05254.1    GBBI01004583    JAC14129.1    MLYV02001214    PSR72099.1    IACF01002639    LAB68284.1    ABLF02006498    GFDL01000236    JAV34809.1    CR848788    GACK01003634    JAA61400.1    GDUN01000835    JAN95084.1    EQ962655    EED18401.1    JXUM01118898    KQ566235    KXJ70294.1    JXNT01000014    ODM15935.1    BX908731    MLYV02001069    PSR73545.1    EQ962654    EED20341.1    DS995764    EGE07676.1    EQ962657    EED15079.1    JXNT01000006    ODM18159.1    IACF01001499    LAB67197.1   
Pfam
PF00075   RNase_H        + More
PF14529   Exo_endo_phos_2
PF00078   RVT_1
Interpro
IPR036397   RNaseH_sf        + More
IPR002156   RNaseH_domain       
IPR012337   RNaseH-like_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR001584   Integrase_cat-core       
SUPFAM
SSF53098   SSF53098        + More
SSF56219   SSF56219       
Gene 3D
PDB
2QKK     E-value=5.35581e-05,     Score=110

Ontologies

Topology

Length:
298
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00842999999999999
Exp number, first 60 AAs:
0.00367
Total prob of N-in:
0.06791
outside
1  -  298
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号