SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00635
Annotation
Retrovirus-related_Pol_polyprotein_from_transposon_TNT_1-94_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 2.798
 

Sequence

CDS
ATGTCGTCAAATAATACGATGGCACTGATTGAAAAGCTGACTGGAAGGGAAAACTATCCTACGTGGAGATTTGCAGTGCAAACATATCTCGAACACGAAGAATTATGGAGTTGTGTCACCGCGAAAGACAATGAAACAATTGATCCCAAACTTGATACAAAAGCTAAGTCAAAAATTATCTTATTAGTACATCCAATCAATTATGTACATATACAAGAAGCCAAAACAGCCAAGGAAGTTTGGAATAATTTAGCCAAAGCTTTCGATGACACGGGTTTGACACGCCGAGTGGGTCTGTTGAGAGATCTTATCAATACCACGCTTGAAAATTGTCTGAACATAGAAGATTATGTTAACAAGATTATGACCGCTGCCCATAAGTTAAGGAACATTGGTTTTAAAGTCGATGATGAATGGCTCGGGACTTTATTACTTGCTGGATTACCAGATATATATCAACCAATGATCATGGCACTAGAAAGTTCAGGTCTGACAATAACGGCTGATTCAGTGAAGACTAAGCTTCTACAAGATGTGAGAAACTCAGAGTCCAGTGCATTGTATGTCAGAAGCAAGGGGAATCAATTTGTCAAACAAACTCAAGATAAAACTAAAACTGGTAAAGGTCCAAGGTGCTATGTGTGTAATAAATATGGGCACATAAGTAAAAATTGCCGAAATAAGAAAAAGGAACAGAAGTCTAATGAGAACACAGATTCTGGTTATGTCGCTGTGTTATCTGCAACAATGAACAACGACAATAATTGGTACATTGATTCTGGAGCGTCAATGCATATGACAATGAATCGTGACTGGCTATATGATGAAATTACACCTCCAATTTCCACAATAAAAGTAGCTAATGACAAAAAGTTAGTTGTAAAAGCTTGTGGAAAGGTAAATCTTAATGTTGTCAATATGCAAGGCCAGTTAGAAACTATCAAGGTGCAGAATGTTCTCTATGTTCCTGAGTTGGCTACTAATCTTCTCTCTGTAAGTCAAATAATAAATAGTGGCTGTCAAGTACAATTTGACAAACAAGGATGTAAAATCTTAAATAAAACAAACAAGCAAGTTGCAGCTGCTAAAATGATAAATAATATGTACAGGCTAGTTACACACAGTGTTCCAGCATACACATCAGCTTCAACAGAGAATGATTCTTATTTATGGCATCAGAGAATGGCACATTTAAATTTTGAAGATTTAAATAAACTATCAGAAAGTGCAGGAGTCACATTAGAAAATACAGACAAAGTGATATGTATCTCATGTTTGGAAGGGAAGCAGACAAGATTTCCATTCCCTTCAGAAGGTTCCAGAGCACAAGCAAAGCTAGAACTTATTCACTCTGATGTCTGTGGTCCAATGGAGACACTGTCTATGGGAGGAGCACGCTACTTTCTTACATTCATCGATGATTTTACGAGGAAAGTATTTGTATATGTTTTAAAAAGAAGATCTGAAGTATTCCAAAAATTTCAAGAATTTAAAGTATTAGTTGAAAATCAACTTGATTTGACAATAAAAACTCTCCGCACAGATAATGGGGCTGAGTACTTGAGCAATGAATTTCAAGGTTTTCTTAAGAAATCTGGAATTATACATCAAACCTCCACTCCGTACTCGCCACAACAAAATGGTTTAGCGGAAAGAATGAACCGCACATTATTAGAAAGAGCCAGATGTATGCTTTTAAATGCAAAACTTCAGAAGCATTATTGGGCAGAAGCTGTGTCAACTGCAGCTTACATCACCAATAGATGTCCAACAAGAGCTTTAGCCTTTTTAACACCGGAAGAAATGTGGAGTGGTAAAAAGCCAGATATCACACATATGAAAATTTTTGGCTGTGAAGTGATGGTACATGTTCCTAAAGAAAAAGCTAAGAAGTGGGACTCAAAGACAAATAAATTGATATTCATTGGATATGGTGAACAAACCAAAGGATACAGGCTTTTAGATCCCAAAACAAGAAAAATCATTATAAGCAGAGATGTGATTTTTCTAGAAAGCTCAGTAAAAAGAAATTATGCTGTGGTACCTTTATCAGCATCAGTCCCAAATACCTGTGAAGATACTTCTGTGACTGAAAGTGGCACAACTTTACAAAATGTATCTGAAAGCATTGAAGGTATTAAGGATGAATCCAGTGATGATTTTTACTCAGATGAAGGATCTTTGTATGAACCAGAGATAAATATAGATCACCAGGAAGTAATGTCAAATGTAACTACAAGATCTAAAGCAAGACTGTGTCAAATGCAAGGAAATACCTATATGTGTAGAAAAGAAATTGTAGGACAGGAAAATATCCCAGAAACATATGATGAAGCTATATCTATTGAAAATGCTAATGCTGCAAAATGGAAACAATCAATTGAGGAAGAACTACAAGCACATGCAAAGAATAAAACTTGGCAATTAATTATGAAACCTGAAGGAGTGCGAGTGATTGGCTGTAAATGGGTCTTCAGAATAAAAGATGACCCATCGGGTCCGTGTTTTAAGTCAAGGCTATGTGCTAAAGGCTGTAGCCAGAAACAAGGAATTGATTATAAAGAGATATATTCTCCTACAGTGAGGTATGATTCAGTTCGAGTTTTACTTTCAGAAGCAGCACAACATAATTTGAATATAATTCAGTTTGATGTCAAAACTGCATTCTTATATGGTGACGTCAAAGAAGACATATATATGTTACCGCCTGAAGGTTTGGATACTAATGCAAATATGTAA
Protein
MSSNNTMALIEKLTGRENYPTWRFAVQTYLEHEELWSCVTAKDNETIDPKLDTKAKSKIILLVHPINYVHIQEAKTAKEVWNNLAKAFDDTGLTRRVGLLRDLINTTLENCLNIEDYVNKIMTAAHKLRNIGFKVDDEWLGTLLLAGLPDIYQPMIMALESSGLTITADSVKTKLLQDVRNSESSALYVRSKGNQFVKQTQDKTKTGKGPRCYVCNKYGHISKNCRNKKKEQKSNENTDSGYVAVLSATMNNDNNWYIDSGASMHMTMNRDWLYDEITPPISTIKVANDKKLVVKACGKVNLNVVNMQGQLETIKVQNVLYVPELATNLLSVSQIINSGCQVQFDKQGCKILNKTNKQVAAAKMINNMYRLVTHSVPAYTSASTENDSYLWHQRMAHLNFEDLNKLSESAGVTLENTDKVICISCLEGKQTRFPFPSEGSRAQAKLELIHSDVCGPMETLSMGGARYFLTFIDDFTRKVFVYVLKRRSEVFQKFQEFKVLVENQLDLTIKTLRTDNGAEYLSNEFQGFLKKSGIIHQTSTPYSPQQNGLAERMNRTLLERARCMLLNAKLQKHYWAEAVSTAAYITNRCPTRALAFLTPEEMWSGKKPDITHMKIFGCEVMVHVPKEKAKKWDSKTNKLIFIGYGEQTKGYRLLDPKTRKIIISRDVIFLESSVKRNYAVVPLSASVPNTCEDTSVTESGTTLQNVSESIEGIKDESSDDFYSDEGSLYEPEINIDHQEVMSNVTTRSKARLCQMQGNTYMCRKEIVGQENIPETYDEAISIENANAAKWKQSIEEELQAHAKNKTWQLIMKPEGVRVIGCKWVFRIKDDPSGPCFKSRLCAKGCSQKQGIDYKEIYSPTVRYDSVRVLLSEAAQHNLNIIQFDVKTAFLYGDVKEDIYMLPPEGLDTNANM

Summary

EMBL
KQ459875    KPJ19636.1    NWSH01000816    PCG74073.1    NWSH01002292    PCG68657.1    + More
PCG68658.1    KQ460297    KPJ16236.1    LBMM01004924    KMQ91985.1    GEZM01011856    JAV93393.1    GEZM01011857    JAV93390.1    GBXI01011094    JAD03198.1    GFTR01008662    JAW07764.1    GEHC01000867    JAV46778.1    GEHC01000868    JAV46777.1    KQ460882    KPJ11482.1    GBHO01033237    JAG10367.1    GBHO01033235    JAG10369.1    GEZM01045162    JAV77889.1    GEDC01002834    JAS34464.1    GAKP01015352    JAC43600.1    JYDH01000330    KRY26802.1    JYDT01000069    KRY86576.1    JYDS01000009    JYDV01000021    KRZ33483.1    KRZ41218.1    JYDJ01000136    KRX42725.1    JYDJ01000808    KRX33413.1    JYDR01000001    KRY80095.1    KL367628    KFD61291.1    GEZM01011858    GEZM01011854    JAV93389.1    KL367553    KFD64618.1    NEVH01006721    PNF37230.1    NEVH01019375    PNF22597.1    NEVH01002725    PNF41351.1    NEVH01006980    PNF36330.1    KQ460208    KPJ16606.1    JXUM01099713    KQ564513    KXJ72145.1    GBHO01026221    JAG17383.1    LVZM01023578    OUC39908.1    JYDQ01000379    KRY07987.1    LBMM01008124    KMQ89126.1    GBHO01020706    JAG22898.1    GEHC01000991    JAV46654.1    GEZM01011855    JAV93396.1    GEHC01000990    JAV46655.1    GBHO01036544    JAG07060.1    GALX01001351    JAB67115.1    GBXI01002679    JAD11613.1    JYDK01000071    KRX78146.1    GEZM01045163    JAV77888.1    GANO01000510    JAB59361.1    GEHC01000989    JAV46656.1    GEHC01000988    JAV46657.1    CM007901    OTG04806.1    GEZM01011859    JAV93384.1    CM007899    OTG12557.1    GANO01000659    JAB59212.1    GEZM01013472    GEZM01013471    GEZM01013470    JAV92539.1    GANO01000660    JAB59211.1    GDUN01000214    JAN95705.1    GAMC01020352    JAB86203.1    CM007900    OTG08534.1    DNYX01000353    HBK84078.1    ASHM01014005    PNX95963.1    LBMM01012669    KMQ86061.1    GDHF01029191    JAI23123.1    JYDU01000001    KRY01876.1    FJ238509    ACI62137.1    GBHO01011746    GBHO01011744    GBHO01011742    JAG31858.1    JAG31860.1    JAG31862.1    FJ544854    ACL97385.1    JYDL01000068    KRX18751.1    JXUM01099923    KQ564528    KXJ72133.1    GAMC01008929    JAB97626.1    FJ544856    ACL97386.1    FJ544851    ACL97383.1    CM003608    KYP66219.1    FJ544853    ACL97384.1    KQ483417    KYP53032.1    GBHO01024949    JAG18655.1    GBHO01024951    JAG18653.1    GBHO01024947    JAG18657.1    GBHO01024950    JAG18654.1    KQ483702    KYP42748.1    AAZX01000798    GGFM01000953    MBW21704.1    KA648745    AFP63374.1    GDHC01012180    JAQ06449.1    GGFM01000952    MBW21703.1    GEHC01000879    JAV46766.1    GGFL01004951    MBW69129.1    GAMC01019995    JAB86560.1    KQ484038    KYP38095.1    OIVN01003986    SPD14739.1    GAMC01020355    JAB86200.1    OIVN01000486    SPC81000.1    KQ484186    KYP36645.1    OIVN01000260    SPC77257.1    OIVN01001906    SPC98838.1    CM003607    KYP67664.1    GBXI01007143    JAD07149.1    GFTR01008771    JAW07655.1    GAMC01019998    JAB86557.1   
Pfam
PF07727   RVT_2        + More
PF00665   rve
PF13961   DUF4219
PF13976   gag_pre-integrs
PF00098   zf-CCHC
Interpro
IPR025314   DUF4219        + More
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR013103   RVT_2       
IPR001584   Integrase_cat-core       
IPR025724   GAG-pre-integrase_dom       
IPR036397   RNaseH_sf       
IPR001878   Znf_CCHC       
IPR039537   Retrotran_Ty1/copia-like       
SUPFAM
SSF57756   SSF57756        + More
SSF53098   SSF53098       
Gene 3D
PDB
5HRR     E-value=3.37809e-05,     Score=116

Ontologies

Topology

Length:
912
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01976
Exp number, first 60 AAs:
2e-05
Total prob of N-in:
0.00103
outside
1  -  912
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号