SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00634
Annotation
Retrovirus-related_Pol_polyprotein_from_transposon_TNT_1-94_[Papilio_machaon]
Full name
Retrovirus-related Pol polyprotein from transposon TNT 1-94      
Location in the cell
Nuclear   Reliability : 3.453
 

Sequence

CDS
ATGTCGTCAAATAATACGATGGCACTGATTGAAAAGCTGACTGGAAGGGAAAACTATCCTACGTGGAGATTTGCAGTGCAAACATATCTCGAACACGAAGAATTATGGAGTTGTGTCACCGCGAAAGACAATGAAACAATTGATCCCAAACTTGATACAAAAGCTAAGTCAAAAATTATCTTATTAGTACATCCAATCAATTATGTACATATACAAGAAGCCAAAACAGCCAAGGAAGTTTGGAATAATTTAGCCAAAGCTTTCGATGACACGGGTTTGACACGCCGAGTGGGTCTGTTGAGAGATCTTATCAATACCACGCTTGAAAATTGTCTGAACATAGAAGATTATGTTAACAAGATTATGACCGCTGCCCATAAGTTAAGGAACATTGGTTTTAAAGTCGATGATGAATGGCTCGGGACTTTATTACTTGCTGGATTACCAGATATATATCAACCAATGATCATGGCACTAGAAAGTTCAGGTCTGACAATAACGGCTGATTCAGTGAAGACTAAGCTTCTACAAGATGTGAGAAACTCAGAGTCCAGTGCATTGTATGTCAGAAGCAAGGGGAATCAATTTGTCAAACAAACTCAAGATAAAACTAAAACTGGTAAAGGTCCAAGGTGCTATGTGTGTAATAAATATGGGCACATAAGTAAAAATTGCCGAAATAAGAAAAAGGAACAGAAGTCTAATGAGAACACAGATTCTGGTTATGTCGCTGTGTTATCTGCAACAATGAACAACGACAATAATTGGTACATTGATTCTGGAGCGTCAATGCATATGACAATGAATCGTGACTGGCTATATGATGAAATTACACCTCCAATTTCCACAATAAAAGTAGCTAATGACAAAAAGTTAGTTGTAAAAGCTTGTGGAAAGGTAAATCTTAATGTTGTCAATATGCAAGGCCAGTTAGAAACTATCAAGGTGCAGAATGTTCTCTATGTTCCTGAGTTGGCTACTAATCTTCTCTCTGTAAGTCAAATAATAAATAGTGGCTGTCAAGTACAATTTGACAAACAAGGATGTAAAATCTTAAATAAAACAAACAAGCAAGTTGCAGCTGCTAAAATGATAAATAATATGTACAGGCTAGTTACACACAGTGTTCCAGCATACACATCAGCTTCAACAGAGAATGATTCTTATTTATGGCATCAGAGAATGGCACATTTAAATTTTGAAGATTTAAATAAACTATCAGAAAGTGCAGGAGTCACATTAGAAAATACAGACAAAGTGATATGTATCTCATGTTTGGAAGGGAAGCAGACAAGATTTCCATTCCCTTCAGAAGGTTCCAGAGCACAAGCAAAGCTAGAACTTATTCACTCTGATGTCTGTGGTCCAATGGAGACACTGTCTATGGGAGGAGCACGCTACTTTCTTACATTCATCGATGATTTTACGAGGAAAGTATTTGTATATGTTTTAAAAAGAAGATCTGAAGTATTCCAAAAATTTCAAGAATTTAAAGTATTAGTTGAAAATCAACTTGATTTGACAATAAAAACTCTCCGCACAGATAATGGGGCTGAGTACTTGAGCAATGAATTTCAAGGTTTTCTTAAGAAATCTGGAATTATACATCAAACCTCCACTCCGTACTCGCCACAACAAAATGGTTTAGCGGAAAGAATGAACCGCACATTATTAGAAAGAGCCAGATGTATGCTTTTAAATGCAAAACTTCAGAAGCATTATTGGGCAGAAGCTGTGTCAACTGCAGCTTACATCACCAATAGATGTCCAACAAGAGCTTTAGCCTTTTTAACACCGGAAGAAATGTGGAGTGGTAAAAAGCCAGATATCACACATATGAAAATTTTTGGCTGTGAAGTGATGGTACATGTTCCTAAAGAAAAAGCTAAGAAGTGGGACTCAAAGACAAATAAATTGATATTCATTGGATATGGTGAACAAACCAAAGGATACAGGCTTTTAGATCCCAAAACAAGAAAAATCATTATAAGCAGAGATGTGATTTTTCTAGAAAGCTCAGTAAAAAGAAATTATGCTGTGGTACCTTTATCAGCATCAGTCCCAAATACCTGTGAAGATACTTCTGTGACTGAAAGTGGCACAACTTTACAAAATGTATCTGAAAGCATTGAAGGTATTAAGGATGAATCCAGTGATGATTTTTACTCAGATGAAGGATCTTTGTATGAACCAGAGATAAATATAGATCACCAGGAAGTAATGTCAAATGTAACTACAAGATCTAAAGCAAGACTGTGTCAAATGCAAGGAAATACCTATATGTGTAGAAAAGAAATTGTAGGACAGGAAAATATCCCAGAAACATATGATGAAGCTATATCTATTGAAAATGCTAATGCTGCAAAATGGAAACAATCAATTGAGGAAGAACTACAAGCACATGCAAAGAATAAAACTTGGCAATTAATTATGAAACCTGAAGGAGTGCGAGTGATTGGCTGTAAATGGGTCTTCAGAATAAAAGATGACCCATCGGGTCCGTGTTTTAAGTCAAGGCTATGTGCTAAAGGCTGTAGCCAGAAACAAGGAATTGATTATAAAGAGATATATTCTCCTACAGTGAGGTATGATTCAGTTCGAGTTTTACTTTCAGAAGCAGCACAACATAATTTGAATATAATTCAGTTTGATGTCAAAACTGCATTCTTATATGGTGACGTCAAAGAAGACATATATATGTTACCGCCTGAAGGTTTGGATACTAATGCAAATATGGTATGTAAACTCAATCGTTCTCTTTATGGCCTTAAACAAGCACCACGGTGTTGGAACCAAAAGTTTGACGCATCACTGAAGAAATTTGGTTTCAACAATAGTCATGCAGATAGGTGTTTGTATATTGGAAAAGTAAACCAGAACAAAGTTTATTTATTATTGTATGTTGATGATGGGCTTATACTTTCTAAGTCAAAGGATTCATTAAATACAGTAATGCAAGAATTAAAGCAAAATTTTGAAATAAAACAGTGTGATTCAAATAATTTTGTAGGATTACAAATTGAAAAATCTGAAAAATATGTCTTTATTCATCAGTCAAAATATATTGAGAGACTATTGTATAAATATAACATGCAAGATGCGAACTGCAATAATATCCCAGTAAGTCCACACACCATTCTGGAGAAAAGCACTGAGTATGTGGACAAGAATATTCCATACCGAGAGGCAGTTGGATCACTAATGCATCTGGCTGTGGTAAGCAGACCTGACATCATGTATGGAGTTAGTCTGGTAAGCAGATATCTTAATTGTTTTGATCACACTCACTGGAATGTAGTCAAGAAAATAATGAAATATTTAAAAGAAACTAAGGACTATGGCATTTGTTACACATCATCTCAGCAAAATAAAATTGAAGCTTATAGTGATGCTGATTTTGCTAAAGATAGTGCCACCCGAAAATCATTAACTGGGTATGTGTTCATTAAAAATGGAGCCGCCATAACATGGGCAACACAACGTCAGCAAAGTGTTGCTTTATCCACCACAGAGGCAGAATTTATGGCTGCTTGCTCTGCGACAAAAGAAGCTTTGTGGTTAAAGAGAATGTTATTAGATATTGGTGAATTTAATCAAGATTCTATATGCTTAAATATGGACAATCAAAGTGCAATCTGTTTAATTAAAAATGTGGACTATCACAAACGCTGTAAGCACATTGATGTTAAATATAATTTTATTAAAGAAAAATATAATGAAAAACATATAGATTTAAATTATGTTTGTACTAAAGAACAATATGCTGATATATTCACTAAAGCTCTGCCTAGGGATAAGTTTCAGTATCTTAGGAGTAAGCTTGGTATTAAGAAATTGAAATAG
Protein
MSSNNTMALIEKLTGRENYPTWRFAVQTYLEHEELWSCVTAKDNETIDPKLDTKAKSKIILLVHPINYVHIQEAKTAKEVWNNLAKAFDDTGLTRRVGLLRDLINTTLENCLNIEDYVNKIMTAAHKLRNIGFKVDDEWLGTLLLAGLPDIYQPMIMALESSGLTITADSVKTKLLQDVRNSESSALYVRSKGNQFVKQTQDKTKTGKGPRCYVCNKYGHISKNCRNKKKEQKSNENTDSGYVAVLSATMNNDNNWYIDSGASMHMTMNRDWLYDEITPPISTIKVANDKKLVVKACGKVNLNVVNMQGQLETIKVQNVLYVPELATNLLSVSQIINSGCQVQFDKQGCKILNKTNKQVAAAKMINNMYRLVTHSVPAYTSASTENDSYLWHQRMAHLNFEDLNKLSESAGVTLENTDKVICISCLEGKQTRFPFPSEGSRAQAKLELIHSDVCGPMETLSMGGARYFLTFIDDFTRKVFVYVLKRRSEVFQKFQEFKVLVENQLDLTIKTLRTDNGAEYLSNEFQGFLKKSGIIHQTSTPYSPQQNGLAERMNRTLLERARCMLLNAKLQKHYWAEAVSTAAYITNRCPTRALAFLTPEEMWSGKKPDITHMKIFGCEVMVHVPKEKAKKWDSKTNKLIFIGYGEQTKGYRLLDPKTRKIIISRDVIFLESSVKRNYAVVPLSASVPNTCEDTSVTESGTTLQNVSESIEGIKDESSDDFYSDEGSLYEPEINIDHQEVMSNVTTRSKARLCQMQGNTYMCRKEIVGQENIPETYDEAISIENANAAKWKQSIEEELQAHAKNKTWQLIMKPEGVRVIGCKWVFRIKDDPSGPCFKSRLCAKGCSQKQGIDYKEIYSPTVRYDSVRVLLSEAAQHNLNIIQFDVKTAFLYGDVKEDIYMLPPEGLDTNANMVCKLNRSLYGLKQAPRCWNQKFDASLKKFGFNNSHADRCLYIGKVNQNKVYLLLYVDDGLILSKSKDSLNTVMQELKQNFEIKQCDSNNFVGLQIEKSEKYVFIHQSKYIERLLYKYNMQDANCNNIPVSPHTILEKSTEYVDKNIPYREAVGSLMHLAVVSRPDIMYGVSLVSRYLNCFDHTHWNVVKKIMKYLKETKDYGICYTSSQQNKIEAYSDADFAKDSATRKSLTGYVFIKNGAAITWATQRQQSVALSTTEAEFMAACSATKEALWLKRMLLDIGEFNQDSICLNMDNQSAICLIKNVDYHKRCKHIDVKYNFIKEKYNEKHIDLNYVCTKEQYADIFTKALPRDKFQYLRSKLGIKKLK

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Aspartyl protease   Complete proteome   Endonuclease   Hydrolase   Metal-binding   Nuclease   Nucleotidyltransferase   Protease   Reference proteome   RNA-directed DNA polymerase   Transferase   Transposable element   Zinc   Zinc-finger  
Feature
chain  Retrovirus-related Pol polyprotein from transposon TNT 1-94
EMBL
KQ459875    KPJ19636.1    NWSH01000816    PCG74073.1    NWSH01002292    PCG68657.1    + More
PCG68658.1    KQ460297    KPJ16236.1    LBMM01004924    KMQ91985.1    GBXI01011094    JAD03198.1    GEZM01011857    JAV93390.1    GEHC01000867    JAV46778.1    GEHC01000868    JAV46777.1    KQ460882    KPJ11482.1    JYDJ01000136    KRX42725.1    JYDH01000330    KRY26802.1    GBHO01033235    JAG10369.1    GEZM01017328    JAV90763.1    GEZM01017329    JAV90762.1    GFTR01008662    JAW07764.1    GEZM01045163    GEZM01045162    JAV77888.1    LBMM01012536    KMQ86167.1    GBHO01036544    JAG07060.1    GEDC01002834    JAS34464.1    FJ544854    ACL97385.1    JYDT01000069    KRY86576.1    JYDS01000009    JYDV01000021    KRZ33483.1    KRZ41218.1    JYDR01000001    KRY80095.1    KQ483417    KYP53032.1    FJ544856    ACL97386.1    KQ483702    KYP42748.1    FJ544851    ACL97383.1    FJ544853    ACL97384.1    KQ484038    KYP38095.1    KQ484186    KYP36645.1    CM003607    KYP67664.1    JN402333    AFB73912.1    GDUN01000214    JAN95705.1    OIVN01000991    OIVN01001835    SPC88370.1    SPC98114.1    OIVN01002055    SPD00174.1    OIVN01006261    SPD29147.1    AB162659    BAD34493.1    X13777    JN402332    AFB73911.1    FJ544857    ACL97387.1    GEZM01011859    JAV93384.1    GBXI01002679    JAD11613.1    GGMR01009345    MBY21964.1    CM007899    OTG12557.1    GEZM01013586    JAV92451.1    KA648745    AFP63374.1    GGFM01000953    MBW21704.1    GAMC01008929    JAB97626.1    GAKP01015352    JAC43600.1    GGFM01000952    MBW21703.1    GGFL01004951    MBW69129.1    KQ483843    KYP40337.1    AAZX01000499    EF094939    EF094940    ABO36622.1    ABO36636.1    JYDH01000102    KRY32233.1    KRY32232.1    OIVN01001931    SPC99063.1    CM007900    OTG08534.1    JYDU01000001    KRY01876.1    GEZM01040221    GEZM01040220    JAV80932.1    FJ238509    ACI62137.1    OIVN01000557    SPC82046.1    CM003608    KYP66486.1    OIVN01002516    SPD04274.1    OIVN01006466    SPD33659.1    JYDL01000068    KRX18751.1    NKQK01000002    PSS35035.1    OIVN01001052    SPC89229.1    GEHC01000927    JAV46718.1    LBMM01007046    KMQ90088.1    ASHM01002084    PNY07765.1    JXUM01085595    KQ563513    KXJ73717.1    OIVN01003683    SPD12935.1    KQ971352    KYB26731.1    OIVN01002854    SPD06945.1    GEHC01000879    JAV46766.1    JYDO01000312    KRZ65659.1    OIVN01006239    SPD28653.1    GEZM01078128    GEZM01078127    JAV63002.1    PDCK01000039    PRQ60431.1    OIVN01000486    SPC81000.1    D83003    BAA11674.1    OIVN01001906    SPC98838.1    OIVN01001534    SPC95017.1    OIVN01005591    SPD23209.1    GFTR01008771    JAW07655.1    GBHO01024947    JAG18657.1    GBHO01024950    JAG18654.1    AM447500    CAN74198.1    JYDP01000350    KRZ01021.1    JYDN01000113    KRX56900.1    AM433482    CAN69340.1    OIVN01000036    SPC73022.1    OTG06758.1    JYDM01000185    KRZ84108.1    GBXI01007143    JAD07149.1   
Pfam
PF07727   RVT_2        + More
PF00665   rve
PF13961   DUF4219
PF13976   gag_pre-integrs
PF00098   zf-CCHC
PF00626   Gelsolin
PF08033   Sec23_BS
PF08534   Redoxin
PF00106   adh_short
PF13696   zf-CCHC_2
PF13855   LRR_8
PF03106   WRKY
Interpro
IPR025314   DUF4219        + More
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR013103   RVT_2       
IPR001584   Integrase_cat-core       
IPR025724   GAG-pre-integrase_dom       
IPR036397   RNaseH_sf       
IPR001878   Znf_CCHC       
IPR039537   Retrotran_Ty1/copia-like       
IPR007123   Gelsolin-like_dom       
IPR029006   ADF-H/Gelsolin-like_dom_sf       
IPR036180   Gelsolin-like_dom_sf       
IPR012990   Sec23_24_beta_S       
IPR036291   NAD(P)-bd_dom_sf       
IPR013740   Redoxin       
IPR020904   Sc_DH/Rdtase_CS       
IPR002347   SDR_fam       
IPR036249   Thioredoxin-like_sf       
IPR037944   PRX5-like       
IPR025829   Zn_knuckle_CX2CX3GHX4C       
IPR032675   LRR_dom_sf       
IPR036576   WRKY_dom_sf       
IPR001611   Leu-rich_rpt       
IPR003657   WRKY_dom       
SUPFAM
SSF57756   SSF57756        + More
SSF53098   SSF53098       
SSF82754   SSF82754       
SSF51735   SSF51735       
SSF52833   SSF52833       
SSF118290   SSF118290       
Gene 3D
PDB
5HRR     E-value=4.62195e-05,     Score=117

Ontologies

Topology

Subcellular location
Nucleus  
Length:
1280
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02335
Exp number, first 60 AAs:
2e-05
Total prob of N-in:
0.00101
outside
1  -  1280
 
 

Population Genetic Test Statistics

Pi
0.05977
Theta
0.503898
Tajima's D
-2.147147
CLR
0.519727
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号