SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00629
Annotation
PREDICTED:_uncharacterized_protein_LOC106138993_[Amyelois_transitella]
Location in the cell
Cytoplasmic   Reliability : 2.08 Nuclear   Reliability : 2.198
 

Sequence

CDS
ATGCCTCCTAAGAAGAATAATGATAATGACGAAAGAGAAGACGTCGAGAAGAAAAACGAAGAAGAAAAAATCCCTTACAAGAAAGTGTTATTGAATGGAACAGAGATGGTGGCTTTTATCGATACAGGTAGTGACGCGAATCTTATTATACAATCAGAATTTGAAAAAATTGAGAATAATGTCCAACATTATGACAAGAATTCAGAAGTTCGTCTTACAGGCATTGCTAACAAAGAAGTACTTATCAAAGGTGTTTTTACTACTCAGCTACAGATTGATGATGCTGTTACGGATATCAAATTTTACATTGTGGAAGATGATATAATACCTGTAAAGCTGATCATTGGCAACCCCATACTGCGTGAATTCGAAGTTAAGTTTACAAGAAATGGTATTGTAATGGAGAAGATTCCACTTTGTGCTATTGTTGTTGAGAAGGACGAGGTCAAAGAAGATTACAAGAAGTTAGAGAAAGAAGATTATAAGAAGTTAGAGAAAGAAGACTGCAAGAAGTTGGTTAAAGTACCTTACCAGAATCATTTGACACAAAATAAAATACTGTACAAAGAGAAGAATGGAAGTAGTTTTATCGCTGTACCAAAGAAGATGGATAAAGAAATTAGAAGACAGAATTATAGGAGAGGACGACTAAAAGTTGAAGATTGA
Protein
MPPKKNNDNDEREDVEKKNEEEKIPYKKVLLNGTEMVAFIDTGSDANLIIQSEFEKIENNVQHYDKNSEVRLTGIANKEVLIKGVFTTQLQIDDAVTDIKFYIVEDDIIPVKLIIGNPILREFEVKFTRNGIVMEKIPLCAIVVEKDEVKEDYKKLEKEDYKKLEKEDCKKLVKVPYQNHLTQNKILYKEKNGSSFIAVPKKMDKEIRRQNYRRGRLKVED

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
221
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00383000000000001
Exp number, first 60 AAs:
0.00211
Total prob of N-in:
0.19289
outside
1  -  221
 
 

Population Genetic Test Statistics

Pi
17.364604
Theta
20.616492
Tajima's D
-0.865148
CLR
0.001351
CSRT
0.16289185540723
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号