SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00619
Pre Gene Modal
BGIBMGA003852
Annotation
PREDICTED:_uncharacterized_protein_LOC101746464_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.745
 

Sequence

CDS
ATGCACGAACCCAAAGACATTAATCCTGTGAAACAAGCCTGGTTGTTCTCCGGTCCGGACACTCCGACCACAACACCATATCTTCGTGTAGCAGTACAATGGTGCTCGCAACCGATGCCGAATTCCATGGATTACATCGGAGTATGGATGGAACAGACGGCTATCTCTGTCGACCCGCTGTTCGTTGCATGGCTTGCTTATAGACCACGTCCGAGATTGTTTGATACGCCATCGCACTCAAACTTATCAAAGAGCTCGTCCACGCAGTTCTATTGGAAGCGTCGTGCAACACCACCGACAACACTAGCTTGGTGTTGCTTCACCAAACTGGTCAGTACACTTAGAAATGTACTTCTTTTCTTCAAGTCCTCAAGCGGTCGTGGAGTCAGCCGTTCCGGGTCTGGTGCTGAATTGGTTCACGTCCGCCCTCGCAGTATCGGATCGAGCAGCGAACCTAGCGAGAAGAAAGAGAAACAGCCTCCGTCTCCGACTAGACCGCCCGTAGACTGGTTGAACGGTGAACGTCTCCTGGCAATCCATGACCGACTCCGCGGCATGCTGGTCAACGTGGAAGTAGGTCTGATGCTGATCTACGTGACCACCAGTACCGTCTCGGCCACCGACTGCTTCACCGTTCGTGACGCAATGGAACGTCACGCTAGTATGGCTCAACCTGTTCTAGCTATCAGTGCCGGACGATTCTTGATATACTCGAGTCTAAACACGAAGCAGCTGTGGCACGAGATACGACACGACGGACCGACGTTCGTCACGCCCAGAACGGAGCAAAAAGATCTGAACTCGTTTCCATGGAAGCTGCGCCTGTCCGACGTCTCCTGCTACACTCTAGAAGTTAAAGCTTCAAGCTCGAACAAGGACAAGGCCCATCGATCGCAGCTGAAGTCGCTGGTGTACGCCACACCGAGGACGGTGTTGGAAATGGTCACGACTACGATCACGCTCTCAGTAGTCACGAAGTCGTTGCAGCAAAAAGCAGCTGCTTCTACTTCTACTAAGAAAGACCATAAGAAGCATCCGGAAGCTAGTGCTGAAGAGGAAACAGTCAAATACTTCATGACTGGAATGGATTTTAAACCATCCACATTGAAAGAATTTGTGCGAGGACCTACCAGACGTAAGAAGACCAATCAAGAGCAAGCAGAGCAGTCTCCGGAGAGGACGGCGCCTCCGAACTTGACCAGCGGGCCGGTCGTGTCCCTCGGAGTGCATCTACACGCGGACACCCCGCCCATCATCATCAGGCTCGATCACGATCAGGTACATACAATATCGGCGACGCTACACAATTTCAAGCACATTTTGAATCTGATGCGGCGAAGTTCAGACGCCGGACCGAGGCAGTCTTTCACGCCACCAGACGGCTCTCACAAATCGTTGATAAGATCCATGTCAGAAATAGAAGAAGGACGAAGCCCTTCAGACGAAACTACTAGCGAGAATAGATCAGACCTTATTTCAATATTCGAATCACATTCAGCACAAGACCTTACCTCCAAATTGAAGACGTTTTTCTGGTTCCAGTGGGTTGTAAGTCGAGCGACCCTTGTAATAGCTGCCAATCATGCCAAATTAGCATTCGACATCGACGATATTATATCGACCATCGACATGCAGTCCCATTATAATCAACTACGAATCAAATTAGCCTCAGCCTCAGTGAGGCAATATGAACGAGTGGGTAGTGACGAGTGGACAGCCGGCGTTCTGGGAGGCAGGGTGCTCGAAGCCCGCGAACCAAGCAATGCCAAAGAGGACAATCATTTCCTATCAATAACTGTCACACAAGCGCAAATATCAAATCTACCTTCCAGCTGGAGAGAAGAACTTCATCCGAAATTACTCGAAAACAAAACAAGCACTGACACGATGTGGGAACTATACGCAACCCTGGCGCCTTTAGAAGTGGTTCTGCAGCCGACCGTCGTGGATCACATCATAGCCCTCGTGCACGAGATGGCGTCTCGATCGTTCTGTCCCCAACAGGTCCAACCAGAGGCCAGCGCTCCCACCGTGTGGCAGTGGCCGTTCTGCTACATAACCGCTGGTGGATTGAGGCTTTTGCTGACTTGTGACGAAGAGGACACGGGACTCGATGACACGTTTATGTTTGTTATCGGAAAGATTTCGGTCAATCCACATCCCGAAAATCCTATTTGCAGGCGCGCGATCAACTCGACCTCGGACTCCGGTTGGGCGAACAACAGCGAGTACGAAGGTCGGCAGTACGAGGTCATAATCAAGAATGTCGCCATAAGATCGGCGCAGTTCAGGCAAATTGTCAACCAGGAGGTGAGCGAAGCGGAGATCCTTAAGGGAACAGGTGGTGAAAATCCAGCCTTAAAATGGAGTCAACCCACTGTCGCTCCTGTTGTAACGCCAATACTACACGCACTCGACATCGGTTGCGTGCTAGCTCCGGCTCTGTACAATTCCGGCACTCTGGTCTGCGGTCCGGCTGTCGAGGTGAACTTAGTATCGGATTGCGCAATAGAGTTGAGCGTTGACCAACTGGACTTATTGCGGCGCGTGATCGAAGACATACGTGATTCTATTCAAGAGAGTAACGAATTATCGTTGCAATTAAACGAAATGAAAGATCACGTATGTCCGTATGCGACAGTCTTAGAGAGCGAACCGCAAGATTTGAACGCCACGTCCAGTGACACGAGTTTTAATGAAGATATAATGAAATATCAAGAGTTCGCGAAGGCCGCCGCGGCGGACTCCGGCGTGGAGACGACATCGCATTCCACCTTCAAATCCGGCAGGTTGGTTGAGGAGCCGACCGTCATACCAAAGAAGTCCATATCCGTAGGTTTTGCTGAGCAGATAACGGACGCTTCGGACTTCCTCGAAGTGTACGTCACTATGGGCATAATAGAGCTGTCTCTTTACACGAAAGATAACTCCAGCCCGGAGGTCGTGGCGCTTCGTCCTCCCGTAGTCGAGAGAGTTGTAGAGCCCGTCCCACTCTTGGAGGTGATCATACATAATTCTCAAGAATCATCAAAACGCGACGAAGACGAGTCACCGGTGGCCAGCAAAAGCAACCCGGAGTCCGTGCCGAATATCGACGTCGGCACGCCCAAGCCGGAACACAATGAAACTCTGCCATTAGCGAGGAAGTCCGAAGGGAATCTGCCTTTAATCCATTTGACGTTGCAACAACCTAATCTGTATTATTGGAGGAAGAAGACACAACGAAGCTTGCAGGTATCCCTCTTCGACTTGTGGTTGGGACTCGGCGTGGGCAAGAATGACAGTCATTGGAGTTTAGTCCTTCTGTCAACTGCAAAAGGCGCAGTTGATCCTGTGACGGACATACCGCCCGCATTGGCCACTATGAAGATACTAGTGCCATCTTCTGGTTACGTGAATTCGTCTTCTAGCTCGAATGCAAAGGGCTCTATAAGAATAGACGTCGAGAGACCGATTCGGCTGGACCTGTGCACGGATCGATTCAAACGTGTCAAAGGAATTATTAATCTCATAAATAAACAAGTACCATATTCGCCCTCAAGACACAATGAAATTACAGCTGAAACTCCTCATTTGTACGGGCTCCGGCGGTTCTTTAGTATTCACGGTATTGAGAGCGTCACAATGCTGACGAGCCAATTAGTAGCGTGCGGTTCAGAAGGCGTTGTGGGATGCAACGCTTCCACGGTACAGATAGCGATCGGCTCCAGACCAGAGAGACTCGCGACCAGGGCTTCGGTCACGGGACTGGTGATCGCCGCCGGACCACCCGAGCGGAGACACCCCATGCTGCAACCCTTGATGATGGGCATCGAACTAGACGCGCAGTGGGAAGCGTGGAGGCGAGCCGAAGGTGGGATGTCTGCGAGGGATCCCACAGTACGTGTTGGGATCGAAGTTGACTGCGTCACTGTGGACCTTAAACCAGAAGACTTGGCAGCGCTGAAAAGAATTAAGAAGACACTGCTAGACATGTCTCGCAATGAACAGGTAGCTACAACCCTCGAGAGTAATGCCAACAATGACATTAACAATGTTGACAACACTGAAGGTCAGCCGACGCCATTGAACGTGGAAAGGCCACCCTCGTTGTCTTCAATAGATACGACTTACAGTACCGAAACAGGCGACCATTACTACAAGGACGATTTGAGGACCGGAGCATTCAAGATAGTCTCTGGTGGTCAGCTGCCGATGGCGTATCAAGTTATATTGCACGGCAGCTGTGTGTCGTGGCGCTACCCTCATCCTCGAGCTATCACTCGTCTCATAGTGTTCCCGTTGCCTGGATTGGTATTTAATGTGCCGAAACTCAAAGGTCGCGAAAATTACGATGATTGGGCGTTCGCAACAAGTAATTTTTTGCTGCTCGAAGGCATTGACTTGGAGAACCTTTCCGCAGAAATGAGTGAAGCTGAGATGAAAAAAGCCAAAGCCAAACTCGTCATGACTATTGACTCTTCATTATACGCGCATATCAAGAGTGAGACTACAGTAATCGGTGTATGGAATAAATTGAAACAATTGTTCGATGACACCGGGTATCAACGAAAAATCAGTTTGCTTCGAACGTTAATTTCAGTTCGCCTCGAAAACTGTGATTCGATGACAAGCTACGTATCTCAAATAGTTGAAACTGCGCAGAAATTGAAGGGCACAGGATTCGAAATCACAGATGAGTGGATTGGGTCATTACTTTTGGCGGGACTCTCAGATAAGTTTTCACCTATGATAATGGCGATCGAACATTCAGGAATCGCCATTAGCGCTGACGTCATTAAGACAAAATTGCTCGATATGTGTGAGGAGGTGGGTACTACTGAAAAAGATTCTGCATTTTGGTCAAAACAACAGCGGTGGAAAAGTGGAAACACTAACCGTGGTGTGAAATCGCAAACGTCAACGTCAAATAGTGACAGAAATGACAGTGCAAGTTCAAATGGCGGTAAACAAATAAAATGTTATAATTGCAAGAAAATAGGGCATTTTAAAAATAAATGTCCCGAACTAAAAACAAAGAAAACCTTAAATGCTTTTAGTGCTGCATTTTTTAACGGAAATTTTAGTACAAAAGACTGGTACGTCGATTCAGGTGCAAGTGCACACATGACGGCAAGTCGAGATTGTTTACAGTTAAATAGACCCGTGCATGAAAACAAAGAAATAGTAGTTGCAAATCAAATGACTGTGCCTGTTGTGAGTGTTGGTGAAACACAGATAACCACGATTGTAAATGGTTCTCAGTATGATGTCATTGTAAAGAATGTTTTATACATACCGAAGCTCACGACAAACTTATTATCGGTAAGTCAACTGATAGCAAATGGCAACAAAGTGTCATTTAAGAAGGATGTTTGTTTAATATATAATCCAGTAAATGAGCTTATAGGAATTGCAAACTTAACTAATGGTGTGTACAAACTACAAATACAAAGACCAGAGAGTGCATTATTGGCCATGACAATGTGGCATAGAAGACTAGGACATGTAAACAGTAAATCTTTAGAAATGATGAAAGAAGGTGCTGTGAAAGGGGTTACTTTTGATAAGAAAGCTGATATTCAGATCAAGAACTGTGAAGTGTGCTGTGAGGGCAAACAGGCTCGTTTCCCTTTCCCATCTGCTAATCATAGAAGTGATATACTACTAGACGTAATACACTCAGATTTATGTGGGCCGATGGAGACCAAATCAATTGGTCAAGCAAAGTACTTTCTTCTGTTCATAGATGATGCCAGCAGAATGACTTATGTCTATTTCTTGAAGGAAAAGAACCAAGTATTCCAGCATTTCAAAGAATTTCGTGTTTTGGTGGAGAATCAAACAGGAAACAAGATCAAAATATTGAGAACAGATAACGGAGGTGAGTTTTGTTCACAAGAGATGGAAGAGTTCTTAAAACAAACTGGAATCATCCATCAGAAGACTAATCCTCACACTCCACAACAGAATGGACTCTCAGAAAGGTTCAACAGAACTGTAGTTGAACGGGCTAGATGTTTACTGTTTGAATCAGATCTCGACAAAAGTTTTTGGGGTGAAGCAGTGAATACTGCAGTATACCTAATGAATAGAATACCAGCTGTCAGTCTAGGCATGATGACACCATATGAGAAGTGGACAGGCAAGAAGCCAGATTTGAGCTATGTCAGGATTTTTGGAAGTAAAGTAATGGTGCATGTTCCCAAAGTGCAAAGACAAAAATGGGATAAGAAGGCTGACAAATTAATTCTAGTTGGTTATCCGGATAACGTGAAAGGTTACAGATTATATAACCCCAAAACCAAGAAGATTACTACGAGCAGGGACGTCATTATAATAGAGAAAGAACACTCGGACACAGCTCAGGTAGTAGTAAATAATGAAAAAGTGTTGGAGAAAGTTGAAAATTCAGAGAAAGAGAGAAGCATATCAGAAAATTCAACTATAGACGCTAACGATCCTACATATATTTATGACTCATCGAGCTCCCACGAAGATTCATATCAATCGGTGTATGAAAGTGAAAATGAGTCAACCTTAGAATCCATTTTAGAAGAAAATATTCAAAACTTACAGGAGCTTGGTAAGCGCAAGAGAAAGCCAGTAGAAAGATATGGCTATTCCAATCTCTGCATTGTAGATGAGCTGGAATCCTGTGGTGAAGAACTGAGTTATGAAACAGCAATAAATGGACCAGAGAAGGAACTGTGGGAACAGGCGATGGCAGAAGAACTGAAGGCATTTGAAGAAAACCAAGCATGGGAATTTGTTGACAGAAAAGAAGCTGATAGGATAGTGCAATGTAAATGGGTTTTTAAGAAAAAGTTTGAATGTGATGGTAAAGTGCGTTATAGGGCTAGACTGGTAGCAAAAGGTTTTACTCAAAAAGAAGGATCTGTTATCTCATATGAATGTAAAAAACAGCAGACTACAGCCCTATCTAGTACAGAAGCTGAATACATGGCGATAACCGAGGCTTGTAAAGAGGCAATATATTTAAAGAACTTGTTGAATGAGATTGTAGATTTTTGTAATTATACAATAACCTTGTACAACGACAATCAAGGGGCTCAGAAGTTGACAGAGAATCCAATGTTCCATAAAAGAACTAAGCACATTGACGTAAACGATATACCGTGCGTCCTAGAGTTTTATATACCGATGCTTGGCAAATGGGAGGCGCACACCCACTTCTCGTTGCCGGTCGGTGAGCCCAACGAACTACGACTCCAGGTCACGCCTCCGGAAACTGTGTTTGCTCAAATATGGCGCTTCCGTATTTACGAGGAGACCGGCAAAGAAACGCCATACGAATTTAAATTAAGCAAGTTCACGCCGAGAAATGATCCTTTGCAAACGGACACGTTTAGCGAGCCACCGGACCCGACCGGTTCAGCATCAGGAGTGACAGCCGAACAGCTCTCGGGCGTGATCCGCGTCGACTCGTACTTCGCACCGCGACTCCTACCGAACACGAGACTCTTCGTGCGAGCAGCGAACATCGAAGTGCATTTCCATAACTCGTTACCTTATTTGACCAGTAATGCAACGGTTTTGGAAGGATACTACGTGTCGCGCCCGTTGATGCGCAGTCACCGCGTGTTGACGTTGTACGCACGCAATCTGACCGCGCACGCCGAACTAGACTCGCCCGCCGGCATATCCGTGTTAATCGACACACGACTCTCATTCGACATCCTGGAGTGCGATACCGGGACAATGGACGGGCTCGTAAGCGAGTTTCCCGCGCAGCTCGCTCTGTCCGTGCCCATGAGTACGCCGCAGCTCGCCAAAGTGCGTGCTCGGCTCGACCTCCTGCGCGTGCGTCTACACGTTCCGAGACTTAGAGTCATACACGCTCTGGTCAAAGACTGGAGGGTAGCCATCGATCAGTATCTTGAAAAAGCCCGACTGGAACCGAACGTGGAATTGGAAACGAAAAATATAAGAACCAAACGAGACTTCGCGGATGCCATGGAGGAAGCGTTGGAAGGACGCGTCTCACTCTGGGTGCACAACAGTTCCTCTGCCGCTCTGAGGATGGGACAAGAGGGAACTGATGAAGTCGTGCCTCTGGGACCTGGAACTAGGCTTGCGTACCGATGGCGTAATCCCACAGCCCCGAAGACGCTTCGGTTTTCTCTCGCTGGTCCCACTGCCGACTGGCATTGGTCTAACAGCATCCCATTCACATTGGGCAGTCATCGAGTGCGCTTAGAAGACGCTGAACGTCTCGGCGGCAAGGGTCCGGGAGCGGGGGTGTTTGTTCATGCCGCGGTGGAAGGGAAAGGGGCTAGATTATGCCTCCATTTGTCAGGACGACTGGTCCTGGCGAACATGCTTAGGTTCGATTTACTATACAAGGTCCGTGCCCGTTGCTCTGATTCGAACCAGTTGTGCACGATCTGTTCGGGCGAGCTCATGTCCGAGGATGTCGGGACGAGCGTCCTCTGCGGAGACGACAGCGAGATGATGCTCAAAATAAAATTCATGTCCCACGACACTGGCTGGTCTGGTGATATACCATTGAAGGAATGCCCCAAAGAAAACGTACCCTGGCTCGTCAAAGTACCGAGTCAAGGCAACGTGCCCTATATGGCGGTCTGGTGCAGAGTGGTGAAGGCTCGCAGCGACGGTCGCATATTAGCTACAGTGTGGCCGCTGTACGTTCTCAAGTCGCACCTGCCTCTCGACACCGATGTTTTAATTAGAACCGAATCCGGTATATCAGTGTCAGAAGCATGTCCGGAGCCGACATCCGCTCCTCTAGTGCAGTCCGCGCCGGGACGCGGCACTAGTGTACATTTACTGGCACCGGGAACTACGTCAGCAAGGCACAATCTGCTCTTCCAATACAGGAATATAGAATGTCCAGTGACAAGAGACGCGGTCCCGCTTCACTACGGCGTGCCGGACACTTCTGTGTTCGAGAAACGTGGGCCGGTCTCTAATGTCGATCACGTCATCGATGAGATCATTAAATGGCTCGATGATTCTGGTCGGAAAGCTCGATCGGACTGGCCCTACTCTATCGTGTCGAAGCAGTGGTGCGGACTGTGGCAGCCGGCTTTACTACAACCACGATCTGACGTCACTGTCCGTTACCAAGCCGTCCGCGCGGGTGGTGGCTGCTGTCTCGAGCTGCAGCTATCCCCGGTGGTGCTGCTCTGCAACGCGGCCCCGATAGCACTAACGCTGCGAGCTTACGACGCGGCGCCCCTGTGCAAGCTCGAACCGGGAACGGTTATCGCACCGCCGTCCACTGTTGTCAAGAAACCTTTCTTCATGTCCGTGGAAATGGGCCGCGAGACGTTTGTTAGCGGCCAGCTGCAGGTCTCCAACGAGGACCCGGGTCGCTACGGAGCCCCGCCTCCGGGGCAGGTGGCCCTCGATCACTCGTTAGAATTCGCCATACAATGCAACCAAAAGGTGGCGCTCATGACAATGTACTATCAACTCATAAAAGAAATAAACGTACTCGGCGTCAACTCGACCTACGAACTTCTCAACAGATTGGATACAAAAGTTATGGTCTCCGCCATTGCTGTGCCGAAAGAGGTCGAAAATGACGTAGCGCTAATGCCGAAGACATTCAAACTAGCAGATCCGACCAAAAGCGTCCACGGATTGCAACTGTGCCGCTTCTGGCTGCAAGGCCGTTGGCGCGGCGGCGACCCATCCGAGCTCCGGCTGTACCTGTGTCTCGCTTTACCTTCCGGGCATTACCCTGCTCACACGCCGGTCCCGGTCAGGCTCGGAGCTGCGCCCCTGAGACGTTCGGTCGCACTCATTGATGCTAACAGAGAGTCGGTCCCGATAGTGATCACGCAAATAAAACACGAAGACAGATGGATGATCTCGGTGGCACGCGACCGCTGCCCGCAGTTCGTCGTGCACAACCGCACGAGGCATACTTTAGCTGTGGCGCAACCCATGATGTCGCCAGAGGAACCCTCCACGTCCGCAGTACCGGTGATGTCGGAATGTTCGGGCGCGGGGTGGTGGTGTATCGCTCATCCCCAAGCGGTGACGCACTACACGACCCCCTCGCACAACAATCGCTACCCTCCGCCGGCTAACACTTTTGACTCCAAGCCGGAAATTCCATTCCTTACCTTCACTATAGTGCACGATGACGGCAACAAGGAGTGGTGTCAGCCGGCTGCGATGACGGATGGCGAGCAACTCGTGCAGCTGCCCGACAACGTAACGATAAAGCTGCGAGTGCACGCGCACCCGCACTCAACGCACATCGAACTGCAGAACGTCGATCAGGACGATATATCGGCCAGCGATATCCGTCGTCGTTTGTTCGGTGCGTTCGCAACACACATATCGCACGAGTCACTAATCGACACCGGCGAATTGTCTGTACCACAGAGTTTAGATCGACTGGGTGGTCATGTGAAATTACTCCATCAGAACGTTGCTCACGAGGAGTCTGGAGAGTCCTCGCCGATACCGTGGGCGAACGAACACGCCATCTGTGGTCCTCAGGGGAGAAACCCCATAGCAGTAGCGGCGGTTACCGTGGAGCACTGCCAAGAGAGTCCCGACGCCGCGGAACTATCCTCTGCAGAATGGGATGAAAACGGCAGGATGTGGCCCCAAAACGAGCAGCTCCGTTGTGTTATCGCTGGGGTCATAGTGGAATTGGCCAGCGCTATGGATACTTTGCCGCTTATCGCGTTGCACGCGGATCGCGTGGCCGTACTGATTGTAGCCGACGCTAAGCGAACGAAAACGGCCATATCGATATCGAACGTGCAAATCGATAATCAACAATACGAAACGGGTCAGTACGACTTCGCGGTCGTCGCGTGCACCCGCGCGGACCCCTCGCCGAGCCCGGACGAGCGCCCGCCCCCGCTCTGGACCATGTTCTCTGCAGACGACGCGTTCGCGACCAAACACGAAAACGCACGAGTGCTTATCAAGATTCAACACGACAACTGGACTGTTTTGACACATACTTTCAAAGAACTAACTGAACTGGATTTCCACGTGGGTCCGCTGGCGCTATACATAGAGGACGCCTACGTCACAGCGCTCGTGGAACTGTCTCGTTTGGCTCAGTCAAGTCCTGATGCGGTGACCGAAGCGGCCTCACTCCTAGCCGAAGAACGATCCCTACAAGTTCCCCTGAGGCTCAGACTACTGCACATAAGGCCACTGGATCTGACGCTAACTTTACACACAGCGGTCCGGATGTACATAGCCCTAGATCAGAGTCCGTTGCGACTGAGCGCGTTCGAGTTACGGGACATGATGACGTCAACGGAGCGGTTGACGCACGCGCTCACCGTGCACTACTTGTCCGCCGCCATACTTGGAGCAGGGTGGGTAGTTGGAGGTCTAGAGTTGCTCGGTGCTCCCGGCGCCCTGGCGGCTCGTGTCGGCAGCGCCACGGGAGGAGTTCGAGGAGTGGCGTCAGCGGCTGTGGCCGCCCTACTGAAATCTCTCAGTGCGTGGGCAGGATCTCTGGCCAGAAACCTGGATCTGCTGGCGGGTGATGAAGAGCACGCGAGAAGAGCGGCAGCTGCCAGGAGGAGACCGCCCCCTAGCTTTGTGGCGGGACTCGTCGCGGGAATCACGAATTTTGCTATTAATATTTTAGGAGCGGTTGGAGGTTTGGCTCACCATCCCTTGGTAGGGGTAGCGGTGGGTGAAACAGAAAGCGGAGCGACCGCCTTGCGAAGGGGTTTGCTGGGTGCTCTGACGAAACCGCTCAGCGCCACAGCTGACTTAGTGGCCTACGCTGGACACGGCTTGTTGAGACAGACCGGCTGGGACCCAGTGCCTCAGCCTCGTCCCACTTTACGATCGAACGAGACGGTATCACGGAACGGCTGGCGACGCGACTGCGTGCGGTGGTCGTTTAGGCTAGCCGAGCTGACCGCCCTCTCGGGGTTCGAAGCCTTGCTGGATAACGCGCCGCTGCAGCTACTCCTCACACACAAGTTCCTGGTTGTAGCCGATCCTCAAACGGAACGTATCGTTGAGATGATCGACTTTCGTTTCTGTACTCTGGAGCCTTACCAGGGACCTGTAATACGGCTTATCGTGACTCAGAGAAGGCAATCGAAGTTGTTAGAGTCCAGGGCGGTGGACGAAGACGACGAATTTCAGATAAGCGCAGCGGCGATGGCGCGAGTGGCTCGGTACACGGGCACAGAGGGCGCGCCGACCTCGGAGTCCCGGGTTCTATCCCTAGTGCCGACAGCTGGGAGGGCTTATGCTCTCCACGTGACTCTAGCAACGCTTCTACATCACAACGTAGATTCTCATTTCCAGTTATTGTAA
Protein
MHEPKDINPVKQAWLFSGPDTPTTTPYLRVAVQWCSQPMPNSMDYIGVWMEQTAISVDPLFVAWLAYRPRPRLFDTPSHSNLSKSSSTQFYWKRRATPPTTLAWCCFTKLVSTLRNVLLFFKSSSGRGVSRSGSGAELVHVRPRSIGSSSEPSEKKEKQPPSPTRPPVDWLNGERLLAIHDRLRGMLVNVEVGLMLIYVTTSTVSATDCFTVRDAMERHASMAQPVLAISAGRFLIYSSLNTKQLWHEIRHDGPTFVTPRTEQKDLNSFPWKLRLSDVSCYTLEVKASSSNKDKAHRSQLKSLVYATPRTVLEMVTTTITLSVVTKSLQQKAAASTSTKKDHKKHPEASAEEETVKYFMTGMDFKPSTLKEFVRGPTRRKKTNQEQAEQSPERTAPPNLTSGPVVSLGVHLHADTPPIIIRLDHDQVHTISATLHNFKHILNLMRRSSDAGPRQSFTPPDGSHKSLIRSMSEIEEGRSPSDETTSENRSDLISIFESHSAQDLTSKLKTFFWFQWVVSRATLVIAANHAKLAFDIDDIISTIDMQSHYNQLRIKLASASVRQYERVGSDEWTAGVLGGRVLEAREPSNAKEDNHFLSITVTQAQISNLPSSWREELHPKLLENKTSTDTMWELYATLAPLEVVLQPTVVDHIIALVHEMASRSFCPQQVQPEASAPTVWQWPFCYITAGGLRLLLTCDEEDTGLDDTFMFVIGKISVNPHPENPICRRAINSTSDSGWANNSEYEGRQYEVIIKNVAIRSAQFRQIVNQEVSEAEILKGTGGENPALKWSQPTVAPVVTPILHALDIGCVLAPALYNSGTLVCGPAVEVNLVSDCAIELSVDQLDLLRRVIEDIRDSIQESNELSLQLNEMKDHVCPYATVLESEPQDLNATSSDTSFNEDIMKYQEFAKAAAADSGVETTSHSTFKSGRLVEEPTVIPKKSISVGFAEQITDASDFLEVYVTMGIIELSLYTKDNSSPEVVALRPPVVERVVEPVPLLEVIIHNSQESSKRDEDESPVASKSNPESVPNIDVGTPKPEHNETLPLARKSEGNLPLIHLTLQQPNLYYWRKKTQRSLQVSLFDLWLGLGVGKNDSHWSLVLLSTAKGAVDPVTDIPPALATMKILVPSSGYVNSSSSSNAKGSIRIDVERPIRLDLCTDRFKRVKGIINLINKQVPYSPSRHNEITAETPHLYGLRRFFSIHGIESVTMLTSQLVACGSEGVVGCNASTVQIAIGSRPERLATRASVTGLVIAAGPPERRHPMLQPLMMGIELDAQWEAWRRAEGGMSARDPTVRVGIEVDCVTVDLKPEDLAALKRIKKTLLDMSRNEQVATTLESNANNDINNVDNTEGQPTPLNVERPPSLSSIDTTYSTETGDHYYKDDLRTGAFKIVSGGQLPMAYQVILHGSCVSWRYPHPRAITRLIVFPLPGLVFNVPKLKGRENYDDWAFATSNFLLLEGIDLENLSAEMSEAEMKKAKAKLVMTIDSSLYAHIKSETTVIGVWNKLKQLFDDTGYQRKISLLRTLISVRLENCDSMTSYVSQIVETAQKLKGTGFEITDEWIGSLLLAGLSDKFSPMIMAIEHSGIAISADVIKTKLLDMCEEVGTTEKDSAFWSKQQRWKSGNTNRGVKSQTSTSNSDRNDSASSNGGKQIKCYNCKKIGHFKNKCPELKTKKTLNAFSAAFFNGNFSTKDWYVDSGASAHMTASRDCLQLNRPVHENKEIVVANQMTVPVVSVGETQITTIVNGSQYDVIVKNVLYIPKLTTNLLSVSQLIANGNKVSFKKDVCLIYNPVNELIGIANLTNGVYKLQIQRPESALLAMTMWHRRLGHVNSKSLEMMKEGAVKGVTFDKKADIQIKNCEVCCEGKQARFPFPSANHRSDILLDVIHSDLCGPMETKSIGQAKYFLLFIDDASRMTYVYFLKEKNQVFQHFKEFRVLVENQTGNKIKILRTDNGGEFCSQEMEEFLKQTGIIHQKTNPHTPQQNGLSERFNRTVVERARCLLFESDLDKSFWGEAVNTAVYLMNRIPAVSLGMMTPYEKWTGKKPDLSYVRIFGSKVMVHVPKVQRQKWDKKADKLILVGYPDNVKGYRLYNPKTKKITTSRDVIIIEKEHSDTAQVVVNNEKVLEKVENSEKERSISENSTIDANDPTYIYDSSSSHEDSYQSVYESENESTLESILEENIQNLQELGKRKRKPVERYGYSNLCIVDELESCGEELSYETAINGPEKELWEQAMAEELKAFEENQAWEFVDRKEADRIVQCKWVFKKKFECDGKVRYRARLVAKGFTQKEGSVISYECKKQQTTALSSTEAEYMAITEACKEAIYLKNLLNEIVDFCNYTITLYNDNQGAQKLTENPMFHKRTKHIDVNDIPCVLEFYIPMLGKWEAHTHFSLPVGEPNELRLQVTPPETVFAQIWRFRIYEETGKETPYEFKLSKFTPRNDPLQTDTFSEPPDPTGSASGVTAEQLSGVIRVDSYFAPRLLPNTRLFVRAANIEVHFHNSLPYLTSNATVLEGYYVSRPLMRSHRVLTLYARNLTAHAELDSPAGISVLIDTRLSFDILECDTGTMDGLVSEFPAQLALSVPMSTPQLAKVRARLDLLRVRLHVPRLRVIHALVKDWRVAIDQYLEKARLEPNVELETKNIRTKRDFADAMEEALEGRVSLWVHNSSSAALRMGQEGTDEVVPLGPGTRLAYRWRNPTAPKTLRFSLAGPTADWHWSNSIPFTLGSHRVRLEDAERLGGKGPGAGVFVHAAVEGKGARLCLHLSGRLVLANMLRFDLLYKVRARCSDSNQLCTICSGELMSEDVGTSVLCGDDSEMMLKIKFMSHDTGWSGDIPLKECPKENVPWLVKVPSQGNVPYMAVWCRVVKARSDGRILATVWPLYVLKSHLPLDTDVLIRTESGISVSEACPEPTSAPLVQSAPGRGTSVHLLAPGTTSARHNLLFQYRNIECPVTRDAVPLHYGVPDTSVFEKRGPVSNVDHVIDEIIKWLDDSGRKARSDWPYSIVSKQWCGLWQPALLQPRSDVTVRYQAVRAGGGCCLELQLSPVVLLCNAAPIALTLRAYDAAPLCKLEPGTVIAPPSTVVKKPFFMSVEMGRETFVSGQLQVSNEDPGRYGAPPPGQVALDHSLEFAIQCNQKVALMTMYYQLIKEINVLGVNSTYELLNRLDTKVMVSAIAVPKEVENDVALMPKTFKLADPTKSVHGLQLCRFWLQGRWRGGDPSELRLYLCLALPSGHYPAHTPVPVRLGAAPLRRSVALIDANRESVPIVITQIKHEDRWMISVARDRCPQFVVHNRTRHTLAVAQPMMSPEEPSTSAVPVMSECSGAGWWCIAHPQAVTHYTTPSHNNRYPPPANTFDSKPEIPFLTFTIVHDDGNKEWCQPAAMTDGEQLVQLPDNVTIKLRVHAHPHSTHIELQNVDQDDISASDIRRRLFGAFATHISHESLIDTGELSVPQSLDRLGGHVKLLHQNVAHEESGESSPIPWANEHAICGPQGRNPIAVAAVTVEHCQESPDAAELSSAEWDENGRMWPQNEQLRCVIAGVIVELASAMDTLPLIALHADRVAVLIVADAKRTKTAISISNVQIDNQQYETGQYDFAVVACTRADPSPSPDERPPPLWTMFSADDAFATKHENARVLIKIQHDNWTVLTHTFKELTELDFHVGPLALYIEDAYVTALVELSRLAQSSPDAVTEAASLLAEERSLQVPLRLRLLHIRPLDLTLTLHTAVRMYIALDQSPLRLSAFELRDMMTSTERLTHALTVHYLSAAILGAGWVVGGLELLGAPGALAARVGSATGGVRGVASAAVAALLKSLSAWAGSLARNLDLLAGDEEHARRAAAARRRPPPSFVAGLVAGITNFAINILGAVGGLAHHPLVGVAVGETESGATALRRGLLGALTKPLSATADLVAYAGHGLLRQTGWDPVPQPRPTLRSNETVSRNGWRRDCVRWSFRLAELTALSGFEALLDNAPLQLLLTHKFLVVADPQTERIVEMIDFRFCTLEPYQGPVIRLIVTQRRQSKLLESRAVDEDDEFQISAAAMARVARYTGTEGAPTSESRVLSLVPTAGRAYALHVTLATLLHHNVDSHFQLL

Summary

Uniprot
ProteinModelPortal
PDB
1C1A     E-value=0.00217877,     Score=106

Ontologies

Topology

Length:
4094
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
37.65875
Exp number, first 60 AAs:
0.62238
Total prob of N-in:
0.04491
outside
1  -  4094
 
 

Population Genetic Test Statistics

Pi
27.251467
Theta
31.454165
Tajima's D
-0.898103
CLR
0.024643
CSRT
0.15699215039248
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号