SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00609
Annotation
PREDICTED:_uncharacterized_protein_LOC101747137_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.497 Mitochondrial   Reliability : 1.929
 

Sequence

CDS
ATGGCGCAGGCGATAGCGGACGAATTGGACATCGCAGTCGGTGTAAGGACGTACTGGACTGACTCCAGTACAGTCCTGACATGGATAAAGACCGACCCACGCACGTTCAAACCTTTCGTCGCGCACCGACTCGCCGAGATAGAAGAGTCAACGAAGCCCCAAGAATGGCGATGGGTGCCTGGCTCGCAAAACCCAGCAGACGACGCAACTAGAGAGGCGCCGGCGGATTTCGACCACACGCATCGGTGGTTTAATGGACCCGAGTTCCTGACGTGGGATGAATCGCGCTGGCCCAAGCCGCGAACATTCAAGCAAGAACCGTCTGGAGAAGAGAAAGAAGCCTTCCTGGTCGCCACGGTGAGGACCGCTGACGCTCGAACCACGCCCGATCCGCACAGATTCTCGAGCTGGGTCAAGTTATTGAGAGCAACAGCCAGGGTCCTCCAATTTATTGAGCTGTGTCGACCCCGGAAGGAGAGCGCCTGCGTGTCCAGACAATTGAAGCAGCAAGATCCTACGTGGAGGACGACACGAACGAAGCAACCCCGATCCACATGGAAGCTAAGGACCCCGGAAGCACCTAAAGAAGCGTGGCTGCTGCTTGATCGAATCCACTTGAAAGAAGGCGGAGAAGATCCTACTGAGAAGCAGCCAAGGAGAGAGCTTCGGTGA
Protein
MAQAIADELDIAVGVRTYWTDSSTVLTWIKTDPRTFKPFVAHRLAEIEESTKPQEWRWVPGSQNPADDATREAPADFDHTHRWFNGPEFLTWDESRWPKPRTFKQEPSGEEKEAFLVATVRTADARTTPDPHRFSSWVKLLRATARVLQFIELCRPRKESACVSRQLKQQDPTWRTTRTKQPRSTWKLRTPEAPKEAWLLLDRIHLKEGGEDPTEKQPRRELR

Summary

EMBL
AF530470    AAQ09229.1    AB042119    BAA95570.1    AB042118    BAA95569.1    + More
JTDY01006922    KOB65592.1    AAZX01023278    LNIX01000003    OXA57597.1    LNIX01000019    OXA44812.1    LNIX01000004    OXA55408.1    OXA55241.1    JXUM01127084    KQ567147    KXJ69602.1    LNIX01000018    OXA45362.1    OXA44855.1    LNIX01000039    OXA39294.1    OXA56382.1    GEBQ01015876    JAT24101.1    GEHC01000914    JAV46731.1    GGFM01004978    MBW25729.1    LNIX01000015    OXA46575.1    JXUM01109099    KQ565290    KXJ71123.1    GGFL01005193    MBW69371.1    LSMT01000075    PFX28896.1    GGFM01005031    MBW25782.1    AJVK01001938    AAGJ04142769    AAGJ04142770    MRZV01000303    PIK53060.1    LSMT01000699    PFX15001.1    LSMT01000016    PFX33015.1    GEHC01000967    JAV46678.1    ADMH02001934    ETN60411.1    JXUM01136032    KQ568367    KXJ69026.1    GGFJ01000302    MBW49443.1    GGFJ01001476    MBW50617.1    JXUM01042990    KQ561346    KXJ78875.1    GGFJ01000218    MBW49359.1    GGFJ01001462    MBW50603.1    GEHC01000872    JAV46773.1    JXUM01013493    KQ560378    KXJ82704.1    APCN01002024    AAGJ04050745    GAMC01017930    JAB88625.1    KL367653    KFD60688.1    DNYX01000180    HBK83090.1    GEHC01000955    JAV46690.1    JXUM01146045    JXUM01146046    JXUM01005879    KQ560203    KXJ83865.1    KL363263    KFD49834.1    AAGJ04008210    AB110069    BAD01590.1    BAD01589.1    KN538444    KHJ40299.1    KL367508    KFD68106.1    AAGJ04080524    KL367520    KFD66876.1    GCES01111900    JAQ74422.1    GCES01132273    JAQ54049.1    GCES01134385    JAQ51937.1   
Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF00628   PHD
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF00078   RVT_1
PF13516   LRR_6
PF18738   HEPN_DZIP3
PF05729   NACHT
Interpro
IPR040676   DUF5641        + More
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
IPR000253   FHA_dom       
IPR019786   Zinc_finger_PHD-type_CS       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR032675   LRR_dom_sf       
IPR027417   P-loop_NTPase       
IPR007111   NACHT_NTPase       
IPR001611   Leu-rich_rpt       
IPR041249   HEPN_DZIP3       
SUPFAM
SSF53098   SSF53098        + More
SSF57903   SSF57903       
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57756   SSF57756       
SSF52540   SSF52540       

Ontologies

Topology

Length:
223
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01372
Exp number, first 60 AAs:
0.01372
Total prob of N-in:
0.07550
outside
1  -  223
 
 

Population Genetic Test Statistics

Pi
20.946964
Theta
32.667306
Tajima's D
-1.107208
CLR
0.057819
CSRT
0.11794410279486
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号