SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00606  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA012223
Annotation
PREDICTED:_paraplegin_[Amyelois_transitella]
Location in the cell
Cytoplasmic   Reliability : 2.104 Mitochondrial   Reliability : 1.577
 

Sequence

CDS
ATGAATATAAATCTCGGTGGATTCAGCCAACTGGGCAGAGCTAAGTTCACTCTAGTGGATTCTATGACCGGTCAAGGCAAAGGTGTGAAATTTGAAGACGTCGCCGGTCTTAGGGAAGCCAAAATTGAAGTTATGGAATTCGTGGACTATCTAAAGAGGCCGGAGCATTACAAGAATTTGGGTGCAAAGGTACCAAAAGGTGCGCTTTTGCTTGGCCCGCCTGGCTGCGGGAAAACGTTGCTGGCTAAGGCGGTGGCTACAGAGGCCAACGTTCCGTTCCTGTCTATGAACGGTTCAGAGTTCATCGAGATGATCGGAGGCTTGGGGGCCGCTAGAGTCAGAGATCTGTTCAAAGAGGCAAGTTCTCGTAAGCCCTGCATCATATACATAGACGAGATGGACGCGGTGGGCAGAGCCAGGGCTTCCGGCACGTCCCCCTGGGGTCCAGGCGGAGGCGAATCGGAGCAGACCTTGAACCAGCTGCTTGTGGAAATGGACGGCATGAAGAGTAGGGAAGGAGTCGTTGTGTTGGCTTCGACTAACAGAGCTGATGTGCTCGATAAGGCGCTCCTCAGACCTGGCAGATTCGATCGTCACATATTAATCGACCTGCCCACCCTCCAAGAGCGCGAGGAAATTTTCGAACGACATCTAAAAAGCATTGTACTAGAAGAGCTGCCAACGTATTACATAAAGAGATTGGCTTATCTTACGCCCGGATTTAGTGGTGCAGATATAGCTAATGTGTGTAATGAGGCCGCCTTGCATGCCGCAAGATTCAAACAGAACATTGTGAAGGCAGCTAATTTAGAATACGCCGTTGAAAGAGTTGTTGGTGGTACCGAGAAACGTAGTCACGCCATGTCGCCGGCCGAGAAGAGGATAGTCGCCTACCACGAGTCCGGTCACGCACTCGTCGGCTGGCTGTTGGAACACACGGACGCTCTATTGAAAGTTACAATAGTGCCTAGAACGAACATGGCTCTAGGTTTCGCTCAGTACACGACGTCGGACCAGAAACTCTACACTAAAGAAGAGCTATTCGATCGTATGTGCATGGCGTTGGGCGGCCGTGCATCTGAAGCCATAACCTTCAATTCAATAACAAGCGGTGCGCAGAACGACTTGGAGAAAGTCACGAAAATAGCCTACGCTCAGGTGAGAGTCTATGGGATGTCGCCAACGGTTGGTCTCGTCTCCTTTCCCGATATCAACGAACGTGGCAAGAGTCCGTTCAGCAAGACCCTCAAGAACCTGATAGATCTGGAAGCCAGGAAGATAATAGCGAACGCTTATTACAGGACCGAAGATATATTGAGAACGAATCAAGATAAACTGAAGAAGCTCGCTGAAGAGCTTCTCAAGAAGGAAACATTAAACTTCAACGAAGTTCAAGGTATATTAGGTCCACCGCCCTTCCCCGGGAAGAAGTTCATCGACCCCGTAGAATTCGAGAACAGCCTCAAGAATATGGAGAAGGCGGCATCCTCTGAAGAGGGCACGCCTGTCGGAGCGCCATCAGCGAAACCAGAGTCGCAGCCTGGGTTGTGA
Protein
MNINLGGFSQLGRAKFTLVDSMTGQGKGVKFEDVAGLREAKIEVMEFVDYLKRPEHYKNLGAKVPKGALLLGPPGCGKTLLAKAVATEANVPFLSMNGSEFIEMIGGLGAARVRDLFKEASSRKPCIIYIDEMDAVGRARASGTSPWGPGGGESEQTLNQLLVEMDGMKSREGVVVLASTNRADVLDKALLRPGRFDRHILIDLPTLQEREEIFERHLKSIVLEELPTYYIKRLAYLTPGFSGADIANVCNEAALHAARFKQNIVKAANLEYAVERVVGGTEKRSHAMSPAEKRIVAYHESGHALVGWLLEHTDALLKVTIVPRTNMALGFAQYTTSDQKLYTKEELFDRMCMALGGRASEAITFNSITSGAQNDLEKVTKIAYAQVRVYGMSPTVGLVSFPDINERGKSPFSKTLKNLIDLEARKIIANAYYRTEDILRTNQDKLKKLAEELLKKETLNFNEVQGILGPPPFPGKKFIDPVEFENSLKNMEKAASSEEGTPVGAPSAKPESQPGL

Summary

EMBL
AGBW02008029    OWR54278.1    KQ460953    KPJ10284.1    NWSH01000649    PCG75029.1    + More
KQ459605    KPI92022.1    KZ149925    PZC77608.1    BABH01017326    BABH01017327    BABH01017328    BABH01017329    KQ971321    EFA00737.1    NEVH01024428    PNF17074.1    PNF17073.1    KK852811    KDR15916.1    GEDC01026393    JAS10905.1    GEDC01007902    JAS29396.1    GEZM01066981    JAV67604.1    GEBQ01030023    JAT09954.1    KB630347    ERL83551.1    GECZ01023271    JAS46498.1    GDIQ01171002    JAK80723.1    GDIP01148985    JAJ74417.1    LRGB01000446    KZS19113.1    GDIP01023308    JAM80407.1    GDIQ01185100    JAK66625.1    GDIQ01017729    JAN77008.1    GDIQ01100990    JAL50736.1    AXCM01005886    KB631202    ERL84158.1    APGK01041927    APGK01041928    KB740998    ENN75828.1    PYGN01000311    PSN48736.1    GDIQ01235592    JAK16133.1    AXCN02002225    GFDL01008334    JAV26711.1    GFDL01008386    JAV26659.1    CVRI01000017    CRK90142.1    APCN01001131    KA650195    AFP64824.1    ADMH02001263    ETN63344.1    AAAB01008846    EAA06300.5    JXUM01054167    KQ561808    KXJ77472.1    CH478124    EAT33893.1    UFQS01000107    UFQT01000107    SSW99714.1    SSX20094.1    GDIP01066199    JAM37516.1    CH940653    EDW62290.2    CH916370    EDW00100.1    NNAY01004963    OXU17169.1    GANO01002792    JAB57079.1    CH902622    EDV34538.1    AL023874    CAA19646.1    AAZX01008957    CM000162    EDX01342.1    GBXI01001544    JAD12748.1    AE014298    AAF45806.1    AAS65257.2    ATLV01012451    KE524793    KFB36783.1    CH954180    EDV45664.1    GBXI01007091    JAD07201.1    CH477606    EAT38370.1    CP012528    ALC49898.1    GDIP01034894    JAM68821.1    GDIQ01199899    JAK51826.1    GAMC01002803    JAC03753.1    GDIP01095895    JAM07820.1    GDIQ01100234    JAL51492.1    GEDC01020597    JAS16701.1    GGMR01001436    MBY14055.1    CH963851    EDW75061.1    GDHF01029354    JAI22960.1    GFDF01011215    JAV02869.1    CH933812    EDW05830.1    LNIX01000001    OXA63570.1    GAKP01001378    JAC57574.1    GFDF01011216    JAV02868.1    GDHF01015992    JAI36322.1    GDKW01002565    JAI54030.1    GBGD01000643    JAC88246.1    CH479209    EDW32708.1    AJVK01002128    CH379064    EAL31599.2    ACPB03008738    GDRN01044354    GDRN01044353    JAI66928.1    GFTR01007828    JAW08598.1    OUUW01000025    SPP89625.1    CCAG010022538    GL451712    EFN78696.1    GECL01002203    JAP03921.1    GGFJ01002324    MBW51465.1   
Pfam
PF00004   AAA        + More
PF17862   AAA_lid_3
PF01434   Peptidase_M41
PF06480   FtsH_ext
PF00098   zf-CCHC
Interpro
IPR005936   FtsH        + More
IPR003593   AAA+_ATPase       
IPR041569   AAA_lid_3       
IPR027417   P-loop_NTPase       
IPR003959   ATPase_AAA_core       
IPR037219   Peptidase_M41-like       
IPR000642   Peptidase_M41       
IPR011546   Pept_M41_FtsH_extracell       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF140990   SSF140990        + More
SSF52540   SSF52540       
SSF57756   SSF57756       
Gene 3D
PDB
6NYY     E-value=5.2474e-129,     Score=1182

Ontologies

Topology

Length:
516
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00453
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00075
outside
1  -  516
 
 

Population Genetic Test Statistics

Pi
27.229046
Theta
19.62718
Tajima's D
-1.537076
CLR
0.007357
CSRT
0.055597220138993
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号