SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00601
Annotation
S33901_reverse_transcriptase_-_silkworm_transposon_Pao
Location in the cell
Nuclear   Reliability : 2.408
 

Sequence

CDS
ATGGTGCTCACACGGCCCGAGAAGATGAGGTCGTCACGCCTTGACCGGCCCGGCAACGAAGCTGTCTCGGGCTCAACATCACAAGACGCACAGCAACGAGCTGTGTCGGCCGCGCCGCGTTCGGGAGTGACGCAGGGACCGCCACCGTTGGCGGCAACCTCCTCCCAGTCAACCGCGCCGCGTTCGGGAGTGACGCAGGGACCGCCACCGATGGCGGCACCCTCCTCCCGAGTGGAAAAGTGTCCGGGAGTGCCGCGGGGCTCACAAGCGATGCCCCCCTCCCGCCAAATATTGCCTACGCAATACTCGCCGGCGTCGCCAACGGGACCGAACAGCGGGGTCTGTCGTCGAGTGGTCAGACCTCCCAGCACCGCGACACCGGCAACAACTTCAGGCGACGCAGCAACGGAGAGCGTCGTATCCGCGAGCCAGAACAGGAAAGAGTCAGCGCTCACGGCCAATCCAATTGTACACGGGTCCCACATCACGGACGCCGCTGCCAAAATCTCGACGACAGAAGAAGGCTCCACACTCCGCGACGGGATGGCGCCACCAGTACGAGGATCTTCAAGAAAGTCGAGTCAACAGTCACAACGGCTGTTGCTTATGGCGCGCCTCAAAGAAGAGCATCTTCGCGCCAAAGAAGAACAAGCCCGACTCCAAGCAGAGCTCGCCGCCGCCCGCATCTCAACATTAGAAGCCGAAGCGCTCGTTGAAGAGGAGGAAGATGCGCGCACAACACTCACGGAGGACGAGAACGAGCAATCACAGCGCATCGACACATGGCTCAGTCAGCAACGATCGATCGCGCTACAGGGAGTCGAAGAAAGAGTAATGCAGCCAACACACGGATCACCAGCCACCATCGAGCAACCGCAACTGGAACTTCCCGCACCAATAGAACAGCTGAAGCTACCGGCCCCTGCCGCGGCACCGATTGCCGCACCTGTCGCACCGAAGAGCGACATCGCCGAACTAGCAGCTGCCATCGCGACGGCCGCCCGCCAAGCCAGGCCCGGACCATCGCATCGGTACTACGGGGAGCTTCCAGTGTACAGTGGATCGCACCAGGAATGGCTCTCCTTCAAGGTCGCCTACGCCGAATCAGCGGACAGCTTCAGCGCCGCAGAGAACACTGCGAGACTTCGGCGTACGTTAAGAGGAAGAGCAAGAGAAGCGGTCGAAAACTTGTTGCTGCATTACACCGAGCCCGCCGAGATCATGCGGACTCTAGAATCGCGCTTCGGACGTCCAGAAGCAATCGCCGCAACGGAGCTGGAACGACTGCGCGCGCTGCCACGCTGCACGGACACACCGAGGGACATCTGCGTATTCGCGAACAAGGTGAACAACGTCGTCGCCGCTCTGAGGGCCCTCGACCGCGTACATTATATGTACAACCCGGAGCTCACCAACATCACATCAGAGAAGCTGCCGTCCACTCTACGCCACCGCTGGTTCGAATTCTCGGCAACTCAACCGGCGGGAGAACCGGACCTCGTCAAGCTGTCGCGCTTCTTACAGCGCGAGGCGGACCTGTGCAGCCCATACGCACAGCCGGAACCAGAGACGAGAGTGGAGAACACCAGCGGTCGGCGGAAGATGGTGAACACGCCTCAGAGGACGCACACCACGCAAGCGAAGGAAGAGAGGAAATGCGCAGCATGTCAGAAGCCGGGGCACATCCCACAAGATTGTCCCGAATTCAAGAGAGCAGCCGTCAGCGAGCGCTGGGATACGGCGAAGCGCGAGAATTTGTGTTTCCGGTGCCTACGGTTCCGGTCTCGGGGACACGTATGCAAAAAGAAGAAGTGCGGCGTCGACAGCTGTGAACGCACGCACCACGAGCTGTTGCATAAGAAGCCAGCATGGCAGAAGCCGAAAGAAAAAGAAGAGGCGGTCACCTCGACGTGGGCCGCAAGAAGTGCGACAGCCTACCTGAAGATGGCGCCAATTACTGTTATCGGACCGGCGGGAGAAGCAGATACATGGGCCCTGCTGGACGACGGGTCGACGATCTCGCTGATTGACGAAGACTTCGCGAGACGAGTGGGCGCCAAAGGACCGATTGAACCCCTCTTCATCACTGCCATCGGAGACAATAAGATAGACGCAACACGCTCACGACGCGTCCCGCTGAAGCTATGCGGACGCACGGGGGAACCGCAAGAACTGAACCTACGGACAGTCAACGGCTTAAAATTAACACCACAGCGACTGAACATCGAAGTCCTCGCGTCGTGCCATCACCTCACCGACCTCCGGCATCACTTCAAAACGAGCTACGCCTCGCCGAAGATACTGATCGGCCAAGACAACTGGCACCTGCTGGTGACGGAGGAGATGCGGACGGGACGACGCGATCAACCAGTGGCGTCTCGTACTCCGCTCGGGTGGGTCGTGCACGGAGCACACCCGGGAGGCAAGAGACAGCGCGTCAACTTCGTGGCACATGCGACGACGGTCGACACGAACGTGGACGAAGCCCTCAAGCACTACGTCGCGATTGAGGGACTCACCGTCGCCGCAAAGACGCCGAAGAACGATCCGGACGAGCGCGCGCTGAAGATCCTGCGAGAGACCACTCAACAGCGACCCGACGGCCGCTACGAGACCGCACTGCTGTGGCGTGAGGAGAGCCTGAGAATGCCCAACAATTTTGAAGCCGCAATAAATCGCCTGACGTCCGTAGAAAAGAAACTGGAGAAGGATCCAAATTTGAAAGAGCGCTACAAGCGACAAATGGACGCACTAGTAGCGAAAGGATACGCCGAAGTAGCTCCGTCAACGGGGACGAAGGACCGAACCTGGTACCTGCCACACTTCGGCGTAACACAACCAATGAAGCAGGAGAAGCTTCGCATCGCGCACAACGCCGCTGCGAAAACTAGAGGGAAGAAGCCCGAACGACTTCCTGCTCACCGACCCGGACCTGCTGCAGTCGCTGCCCGGAGCGATGATGCACTTCAGGCAGCACGCCGTTGCCGTCTCCGCGGACATCGCGGAGATGTTCATCCGGATAGGCGTCCGAAGCGAGGACCGCGATGCGCTCCGGTACTTGTGGAGGGAGGACCCTTCACGAGAGCCCACAGAATACCGGACGAGGTCCATCGTCTTCGGCGCGACAAGGTCACCTGCAACCGCCATCTAAGTGAAGAACCGACTGCAGTACCCGGACGCCGCCGACCTCAAGCTCCACACAAAGCCAGACAGACACGAGTGCTCTGGACCGACAGCGCCACCATAGAAGAAAACAGCACTGTGGAGGAATGGCGCTGGGTCCCCACAAGAGAGAATGTCGCCGACGACGCCACAAGAGGAATACCCGTCGGCTTTGAAAGAAACCACCGCTGGTTCATAGGCCCGGAATACCTAAGACGGCATCCGGATGATTGGCTCGTACAACGGACTGCAAGAAGGGCAGAAGAGACGGGTGAAGAGAAGTGCGCAACGCTCGCCGTGAGCAGAGAGAGCCTCGGCGAAGCGATCCCGGACCCAAGACGCTTCTCCAAGTGGGAGAAGTACCTGCGTGCAACGGGGCGAATACTACAATTCGTCAGCCTATGCCGCAGGAGTCGCGAGCGCACTCATTACAAGAGGACCAGGCGGAACCCGCGTTCGGACCCGACGTGGGAGAAGAATAGAAAGAAGACGACTTCGAAGACCCCGCTGAACACACCGCGGACGCCAGAGCAAGCAGTCATCCAATGGAAGACTTTAGACGCCGACACGCTTCGACGCGCCGAGACGCTCATTTGGCGACAGAGCCAGCGGGCGGCCTTCGAGGAAGAGATTTTGACGCTCCAGCGAGGGAAACAAATATCCCCAGCGAGCCGACTGCGAAACTTGTCCGTAACTTACGCGGACGGGATATTGAAAATTAACGGACGCATCGGCAACATAGAGGGAGCTGACGTCATCACCTCGCCTCTCGTGCTAGACGGATCCCGACGCGAAACGAGACTGATGATAGACTTCATCCATAGAAAGATGCACCACGCCGGAACCGAAGCTACGATCGCCGAGTGCCGACAGTCAAGCACCCAGAAGCGCTACGTGGCCATCTTCACATGTCTCACTGCGCGTGCGGTACACTTAGAACCGGCAGCGAGCCTCAGCACGGACTCAGCGGTGATGGCACTCCGGCGCATGATCGCGCGCCGGGGAGCCCCGACGGAGATATGGAGCGACAACGGCACCAATTTACGAGGTGCCGACAAGGAGCTGCGCCAAGCTATGGACAAGGCGACTGAGCATGAAGCGAGCTTAAGACTTATCCAATGGCGCTTCATCCCACCGGGCGCGCCTTTCATGGGCGGCGCCTGGGAAAGAATGGTGCGGGCGGTAAAGGCCGCGCTCTCGGCCACGGAACAGCCGAGGCACCCGACGCCCGAAATATTTCACACTCTGCTAGCGGAGGCAGAGTTCACAGTGAACAGCCGACCTCTCACTCACGTATCGGTGAGCGCCGACGATCCCGACCCTCTAACACCGAACCACTTCCTGCTGGGAGGCCCGGCGCGAGTCCCCGTGCCGGGCAAGTTTGACGACGCCGACCTCATAGGGCGCGCACACTGGCGCGCAGCTCAACGTCTGGCAGATGTGTTCTGGAGTCGCTGGCTCCGGGAGTACCTGCCCGACCTGCAGAACCGGCGGGAGCCCCACAGCCGCGGGCCCGCCCTGAAGATAGGCGACGTCGTGATAATAGCAGACGGAACGCTCCCACGGAACACCTGGCCACGAGGGATCATCCAGGAGGTTTACCCGGGGGCCGACGGCATCACTCGAGTGGTCGACGTGCGCACCGCCGGCGGTATCCTGCGACGCCCGGCAAAGAAGATCATCGTGCTGCCCACGATGTCCGCCGCTCACCAGGGAGGATGCAGCGACGTGAACGACGCTGCACGGCGGGAGGATGTTCGCGACGGACATGAATAA
Protein
MVLTRPEKMRSSRLDRPGNEAVSGSTSQDAQQRAVSAAPRSGVTQGPPPLAATSSQSTAPRSGVTQGPPPMAAPSSRVEKCPGVPRGSQAMPPSRQILPTQYSPASPTGPNSGVCRRVVRPPSTATPATTSGDAATESVVSASQNRKESALTANPIVHGSHITDAAAKISTTEEGSTLRDGMAPPVRGSSRKSSQQSQRLLLMARLKEEHLRAKEEQARLQAELAAARISTLEAEALVEEEEDARTTLTEDENEQSQRIDTWLSQQRSIALQGVEERVMQPTHGSPATIEQPQLELPAPIEQLKLPAPAAAPIAAPVAPKSDIAELAAAIATAARQARPGPSHRYYGELPVYSGSHQEWLSFKVAYAESADSFSAAENTARLRRTLRGRAREAVENLLLHYTEPAEIMRTLESRFGRPEAIAATELERLRALPRCTDTPRDICVFANKVNNVVAALRALDRVHYMYNPELTNITSEKLPSTLRHRWFEFSATQPAGEPDLVKLSRFLQREADLCSPYAQPEPETRVENTSGRRKMVNTPQRTHTTQAKEERKCAACQKPGHIPQDCPEFKRAAVSERWDTAKRENLCFRCLRFRSRGHVCKKKKCGVDSCERTHHELLHKKPAWQKPKEKEEAVTSTWAARSATAYLKMAPITVIGPAGEADTWALLDDGSTISLIDEDFARRVGAKGPIEPLFITAIGDNKIDATRSRRVPLKLCGRTGEPQELNLRTVNGLKLTPQRLNIEVLASCHHLTDLRHHFKTSYASPKILIGQDNWHLLVTEEMRTGRRDQPVASRTPLGWVVHGAHPGGKRQRVNFVAHATTVDTNVDEALKHYVAIEGLTVAAKTPKNDPDERALKILRETTQQRPDGRYETALLWREESLRMPNNFEAAINRLTSVEKKLEKDPNLKERYKRQMDALVAKGYAEVAPSTGTKDRTWYLPHFGVTQPMKQEKLRIAHNAAAKTRGKKPERLPAHRPGPAAVAARSDDALQAARRCRLRGHRGDVHPDRRPKRGPRCAPVLVEGGPFTRAHRIPDEVHRLRRDKVTCNRHLSEEPTAVPGRRRPQAPHKARQTRVLWTDSATIEENSTVEEWRWVPTRENVADDATRGIPVGFERNHRWFIGPEYLRRHPDDWLVQRTARRAEETGEEKCATLAVSRESLGEAIPDPRRFSKWEKYLRATGRILQFVSLCRRSRERTHYKRTRRNPRSDPTWEKNRKKTTSKTPLNTPRTPEQAVIQWKTLDADTLRRAETLIWRQSQRAAFEEEILTLQRGKQISPASRLRNLSVTYADGILKINGRIGNIEGADVITSPLVLDGSRRETRLMIDFIHRKMHHAGTEATIAECRQSSTQKRYVAIFTCLTARAVHLEPAASLSTDSAVMALRRMIARRGAPTEIWSDNGTNLRGADKELRQAMDKATEHEASLRLIQWRFIPPGAPFMGGAWERMVRAVKAALSATEQPRHPTPEIFHTLLAEAEFTVNSRPLTHVSVSADDPDPLTPNHFLLGGPARVPVPGKFDDADLIGRAHWRAAQRLADVFWSRWLREYLPDLQNRREPHSRGPALKIGDVVIIADGTLPRNTWPRGIIQEVYPGADGITRVVDVRTAGGILRRPAKKIIVLPTMSAAHQGGCSDVNDAARREDVRDGHE

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
1645
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0011
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1645
 
 

Population Genetic Test Statistics

Pi
25.315194
Theta
28.407661
Tajima's D
-1.6073
CLR
0.000086
CSRT
0.0467976601169941
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号