SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00597
Pre Gene Modal
BGIBMGA012226
Annotation
PREDICTED:_succinate_dehydrogenase_[ubiquinone]_flavoprotein_subunit?_mitochondrial-like_isoform_X1_[Bombyx_mori]
Full name
Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial       + More
Succinate dehydrogenase (quinone)      
Succinate dehydrogenase [ubiquinone] flavoprotein subunit B, mitochondrial      
Alternative Name
Flavoprotein subunit of complex II B
Flavoprotein subunit of complex II
Location in the cell
Cytoplasmic   Reliability : 2.226
 

Sequence

CDS
ATGCACCCGGATGATTGGCGCTGGCACTTCTATGATACTGTCAAAGGCTCGGATTGGCTAGGAGATCAGGACTCAATCCACTATCTCACGCGTGAAGCACCAAACGTGGCTATAGAATTGGAAAATATGGGTATGCCATTCTCAAGGACTAAAGATGGCAAGATCTACCAGAGGCCTTTCGGTGGAAGTACCACGCACAACGGTAAAGAAGTGGCTAAAAGGACCTGCTGTGTTGCTGATAGAACCGGTCACGCTCTCCTCCACACTCTCTACGGCTACAGCACCAAGCTGAAGAACATTGACCACTTCGCTGAATTCTTTGTGCTAGATCTTCTGATTCAAGACGGAGTTGTGGTCGGGGCGGTAGCGCTCGACATGGACGACAGCAGTATACACAGGTTTCAAGCAAAGAACACGGTGATCGCAACAGGGGGCTACCCCCGTATGTATTTCTCGTGCACAGCGGCCCACACTTGCACCGGTGATGGATGCGCCATCGCTACGAGAGCTGGTATCATGTTGCAGGACATGGAGTTTGTGCAGTTTCATCCGACAGGCATGTATGGTTCCGGTTGCCTGATGACGGAGGGCTGTCGTGGAGAAGGTGGCTTCCTCGTAAACAGCAAGGGCGAGAGGTTTATGGAGAAGTACGCCCCAAAAGCCAAGGATCTGGCCAGTAGAGATGTAGTCTCTAGATCGATTGCTACCGAGATACGAGAAGGGCGTGGAATAGGACCGAATAAGGACTACGTTCACCTTCAGCTGCACCATTTGAAGCCGGAAGTAATCAAGGAGAGGCTGCCCGGTATTTCGGAGACGGCTTGGACATTCACCGGAGTGGACGTCTACACACAGCCTCTACCGGTCTTGCCGACGGTTCATTATACGATGGGCGGCATCCCAATCAATTACAAGGGAGAGGTTGTGATTCACGAAAACAATAAGGATTGCCCGGTGCCGGGACTGCATGGGGCCGGGGAGGCGGTCAGCAACTGCCACGGCGCCAACCGTCTTGGAGCCAACTCCATTCTTGACATTGTGGTGTTCGGCAAGGCAATCAGCATCAACATTGCAAAGAACAGCAAGCCGGGCGATAAGCAACCAGATTTGAAAGACGTTAGTTGGGCGGCAACAAAAATCTCTCCATATTTTAGTTGA
Protein
MHPDDWRWHFYDTVKGSDWLGDQDSIHYLTREAPNVAIELENMGMPFSRTKDGKIYQRPFGGSTTHNGKEVAKRTCCVADRTGHALLHTLYGYSTKLKNIDHFAEFFVLDLLIQDGVVVGAVALDMDDSSIHRFQAKNTVIATGGYPRMYFSCTAAHTCTGDGCAIATRAGIMLQDMEFVQFHPTGMYGSGCLMTEGCRGEGGFLVNSKGERFMEKYAPKAKDLASRDVVSRSIATEIREGRGIGPNKDYVHLQLHHLKPEVIKERLPGISETAWTFTGVDVYTQPLPVLPTVHYTMGGIPINYKGEVVIHENNKDCPVPGLHGAGEAVSNCHGANRLGANSILDIVVFGKAISINIAKNSKPGDKQPDLKDVSWAATKISPYFS

Summary

Description
Flavoprotein (FP) subunit of succinate dehydrogenase (SDH) that is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q).
Catalytic Activity
a quinone + succinate = a quinol + fumarate
Cofactor
FAD
Subunit
Component of complex II composed of four subunits: a flavoprotein (FP), an iron-sulfur protein (IP), and a cytochrome b composed of a large and a small subunit.
Similarity
Belongs to the FAD-dependent oxidoreductase 2 family. FRD/SDH subfamily.
Keywords
Electron transport   FAD   Flavoprotein   Membrane   Mitochondrion   Mitochondrion inner membrane   Oxidoreductase   Transit peptide   Transport   Tricarboxylic acid cycle   Complete proteome   Reference proteome  
Feature
chain  Succinate dehydrogenase [ubiquinone] flavoprotein subunit B, mitochondrial
EC Number
1.3.5.1
EMBL
BABH01017291    KQ460953    KPJ10276.1    KQ459605    KPI92015.1    KZ150069    + More
PZC74085.1    AGBW02013270    OWR43708.1    NWSH01001792    PCG70127.1    ABLF02018996    KU229876    ANJ45171.1    KZ149894    PZC78885.1    AGBW02008935    OWR52136.1    GGMS01018011    MBY87214.1    GCES01005277    JAR81046.1    AXCM01000168    AXCN02001756    GGFM01006662    MBW27413.1    GGFK01002780    MBW36101.1    GGFK01002760    MBW36081.1    APCN01005154    GGFJ01003028    MBW52169.1    ADMH02000002    ETN68137.1    GCES01037928    JAR48395.1    GFTR01007611    JAW08815.1    AAAB01008849    EAA07202.4    CM004477    OCT74354.1    UFQS01000020    UFQT01000020    SSW97497.1    SSX17883.1    BC047261    JARO02014423    KPP58208.1    LIAE01010763    PAV55589.1    GBYX01471314    JAO10336.1    GBBI01000219    JAC18493.1    MTYJ01000013    OQV23244.1    RJVU01042611    ROL45048.1    AERX01010366    LIAE01006560    PAV87568.1    ATLV01016449    KE525091    KFB41348.1    AJWK01017478    AJWK01017479    AJWK01017480    AJWK01017481    AJWK01017482    AJWK01017483    GADI01000354    JAA73454.1    GADI01001448    JAA72360.1    CR848322    BC135730    AFYH01107019    AFYH01107020    AFYH01107021    AFYH01107022    AFYH01107023    AFYH01107024    AFYH01107025    GEFM01003223    JAP72573.1    GCES01150024    JAQ36298.1    HADW01018479    HADX01008097    SBP30329.1    KM098145    AIS22434.1    HAEC01009060    SBQ77276.1    DQ402973    ABD77306.1    AEFK01053046    AEFK01053047    AEFK01053048    KC217615    AGV76821.1    BC164560    AAI64560.1    CP026243    AWO96989.1    GFWV01009182    MAA33911.1    GG666531    EEN58362.1   
Pfam
PF02910   Succ_DH_flav_C        + More
PF00890   FAD_binding_2
Interpro
IPR027477   Succ_DH/fumarate_Rdtase_cat_sf        + More
IPR014006   Succ_Dhase_FrdA_Gneg       
IPR015939   Fum_Rdtase/Succ_DH_flav-like_C       
IPR003953   FAD-binding_2       
IPR003952   FRD_SDH_FAD_BS       
IPR037099   Fum_R/Succ_DH_flav-like_C_sf       
IPR036188   FAD/NAD-bd_sf       
IPR011281   Succ_DH_flav_su_fwd       
SUPFAM
SSF51905   SSF51905        + More
SSF56425   SSF56425       
SSF46977   SSF46977       
Gene 3D
PDB
2WQY     E-value=4.74359e-154,     Score=1396

Ontologies

Topology

Subcellular location
Mitochondrion inner membrane  
Length:
385
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.22598
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01744
outside
1  -  385
 
 

Population Genetic Test Statistics

Pi
18.150441
Theta
27.00586
Tajima's D
-1.047446
CLR
0
CSRT
0.129243537823109
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号