SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00577
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.448 Nuclear   Reliability : 1.89
 

Sequence

CDS
ATGGACGCTGTATTCGCGGAATTCCTCCGACTTCGCCACCCACAGCTCGCCTCGGAGTTTTTGGCCTTCAAGGCCAATCACACTGCGAGCCCTCTCGAGGACTCCGCCGCGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAGAGCTTCTGCATTGAGCACCGCAGCCTCTGTCGTGCCTGCCGCTCCCGTGTCGCCTATACTGGCGAGAAAAGCTGCTGCGTCGTCCGCCGTGACCATCGTTTCAGCTGAGCGATCATCCGCGGCCTCCGTCGCGCCCTCTAAAACACCTACACTTGCTCGTAGGTCGCCTGCACCCGCCTCCTCGTGCTCCGACTCTGACTCGGACATGGAGGTCGACCTCGCCCCCGCCTCATCGACGGATGGATTCACCCTGGTACAGAAGGGTAAGAAGCGTGCCGCGGAGTCTCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCCGTGAACGCGTCGCGCCCCCGCCCTCAGACTCCCGTTGCGCCCCCAGCCCGTGCCACTCCGTCGCCGCGTCCGGTGGCACAAAATAAAACCCAGACCCCTCCCCCGGTTATCCTTCAGGAGAAGGCAGCTTGGGATCGAGTTTGCCTGGCCCTTAAGGCCAAAAATATAAATTTCACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCAAACACCCGACGACCATAGGGCCCTCTCTTCTTACCTCCGTAAGGAGCGTATAAGTTTCCATACGTATACGCTCCAGGAGGAGCGCGAACTCCGCGTTGTAATACGCGGAATCCCTAAAGAGTTAGATGTAGAGCTCGTAAAAGCCGACCTGTTAGAACAAGGCCTACCAGTGAATTCTGTGCACCGTATGCACACCGGTCGCGGTAGGGAGCCATATAATATGGTTCTAGTCGCTCTCCAGCCTACCCCCGAGGGTAAGAAAATCTTTAACACACAGACCGTCTGTAGGCTCTCTGGTATCGCTGTCGAAGCCCCCATAAAAAAGGCACTCCTAGCCAGTGCCATAACTGTCAATTTGCAGGAGACCCTACTTAAGCCCGCGCGCCGTGACCCTAAAATCGCGAACTATAACATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTTCCGTTTAGTCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCGTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCCGACGACATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATCCGTGCGTACGATAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCACCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCTCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATATACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGTGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MDAVFAEFLRLRHPQLASEFLAFKANHTASPLEDSAALAAPASPVPACRASALSTAASVVPAAPVSPILARKAAASSAVTIVSAERSSAASVAPSKTPTLARRSPAPASSCSDSDSDMEVDLAPASSTDGFTLVQKGKKRAAESRAPAAAKISKAVNASRPRPQTPVAPPARATPSPRPVAQNKTQTPPPVILQEKAAWDRVCLALKAKNINFTNARNLANGIQIKVQTPDDHRALSSYLRKERISFHTYTLQEERELRVVIRGIPKELDVELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEGKKIFNTQTVCRLSGIAVEAPIKKALLASAITVNLQETLLKPARRDPKIANYNMVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFSPDSIPSPQDTAEAIDIVTSHITSTLDRSSKQVVAEDFLHRFKLPDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRITEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGNRTRRTRQRGRRAT

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
1264
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.13456
Exp number, first 60 AAs:
0.00071
Total prob of N-in:
0.00010
outside
1  -  1264
 
 

Population Genetic Test Statistics

Pi
1.644831
Theta
1.782634
Tajima's D
0
CLR
0.218319
CSRT
0.418579071046448
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号