SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00572
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.347
 

Sequence

CDS
ATGAGCAGGTCTTATAAGAGTAAAAGTGTGCGTTGCGATCCGAGTAGCGACCGGCGCCCTAAGTTGTCCGGGAACCGGGGTGTGAAATTGGTTACCGGCCATGGGGGAGCAGGCGACCAGGCACCTCATGGAAATTATGCCACTGGAAGAAGAACAACAAAACTCCAATTACGTAATGATATCCGCATCGGAACGTGGAATGTGAGAGGCCTCATCGATGAAGGAAAGCTCCACGTACTGGATCACGAACTCGAGCGATGTAATACGGTTATTACGGGACTAAGTGAGACGCATTGGAAAGAGAGTGGGCACAGAAACCTGGAGAACCACACCATCTACTTCTCAGGAAATGAATTATCTAGCTTTGCTGGAGTGGGTATCGCAATACCCAAGCTCTGGACTGAGTCGGTCCTGGGCTATAATCCTGTCAGCGACAGGATCATCACCATGAAACTCAGTGCTTCACCATGTGCACTGAATATCATTCAGGTCTACGCCCCTACTAGCGCTGCTACTGAGGAAAAAATTGAGAGCTTCTATAATCAACTCGAGGCTTGTATAAACAACATCCCAAAAAGAGAGATACTGATGATTATCGGCGACTTTAACGCAAAGGTTGGAACCACTGTTTTGGATGTAGGGTTACGAAATATCGTGGGTCACTACGGTCTTGGTTGCAGGAACAGTAGAGGAGAACGGTTGATTCAGTTTGCGGCAGATAATAACTTAACAATAATGAATACAGCCTTCAAACACCACCCCAGAAGACTGTATACTTGGACATCCCCAAACGGAGAGCACCGCAACCAAATCGACTATATACTGATCAAGACAAGATGGAGAAGCTCAATAACCAACGCTCATACACTACCGGGAGCTGATGTCACGTCGGATCACCAGCTACTAATATGCAATATGAGGATCAGACTGCGTAGACCTATAATTAGAAAAACTGTCAAACGCCTAGAAGTCATTGATAGAAACTCGTTTGTCCAGTCTCTTCAGGATATGGAACAGTGCTGGTACGAAAACTGCAGCAAGGAAGTGAGCGTTGATCACCTCTGGCAATCTACCGTGCAATTTATAAAAGATGTCGTGCACGAATCACAGCCCAAAAAGAAATCCAAGAAAAGGCAGCATTGGATGTCTACCGAGACCTGGGACTTAATTGAGAAGCGTAGAGAGCTTAAGGCTGGCGGTGTCAGAATGCAGGAGTTGAACGTCATGAGCTCCGCCATACAGGCTGCTTGCCGTCGTGACCGAAACACAGCGCTACAATCAATATGTGAAGAGGTTGAAAGGCATTCTCAAAATTTTGAAACAAAAGATTTACACATGAAAATCAGACTTATAACCCGTCAATTTAAGCCAAAGACTTGGGCTATTGAGAATGCGTCTGGAGATACTGTCACTGAGATCAAAAAGATTGTTAGTGCTTGGAAAGACTATTGCAAGTCTCTGTTTACTGACACCACAACAAAGATCTCAATGACCTACAGTGAACCCTCGGAACTGGAGCCGATGCCTTTGAAGGACGAGGTGCGAGCAGCAATCAACCACCTTAAACGGAATAAGGCTGTAGGTTTTGATGAAATCCCCATCGAGACAATAAAAGCCATGGGGGAAATCGGAGTGGATATACTGCACATCATCTGTTGTCGAATTTGGGTCACTGGAGTTTGGCCGAGCGATTGGTCACATTCGATATTCATTCCACTTCACAAAAAGGGATCAACGAAGAAGTGCAATAACTACAGACTAATTTCTCTCGTATCCCACGCCAGTAAAGTCATGCTGCACATAATTAACACGAGGCTCCAAGGTTACTTGTCCCGAGAGATCGCCCCCGAGCAAGCAGGATTTGTAAAAGGTCGAGGCACAAGAGAGCAACTACTCGTAATGCGGCAAATTGTAGAAAAGGCCAGAGAATTTAATATTAGCCTATATGTGTGCTTCGTGGATTTCCGAAAGGCTTTTGATACCGTCAAGTGGTGGAAGCTGTGGTTGGTACTGACGGAAATGGGTGTACCGCAACATCTTGTACACACCATCAGACGTCTGTACGAAGATGGCACGGCCGCTGTTCGTGTTGACAGTATTGACTCCGAACGCTTCAGCACACAGGCAGGCGTTAGGCAGGGCTGCATACTATCTCCTCTTTTATTTAATATATACACAGAGTATATAATGCGGATAGTTCTTGATGATTGGGATAAAGGAATATCCGTTGGTGGTCGGAAAATATCAAACTTGAGATACGCCGATGATACTACCCTCTTGGCGTCAACCAGAGACGAAATCGAGGTGCTTCTTCGCCGGCTGGAGACTACAGCGTTGGATTTTGGACTTGCGATCAATCGTGATAAGACCAAAATGATGATCGTAGATCGTGCTAACATCAACCAACCGGAAGTCCAACATATAGCGGGATGCGAGGTAGTTAATAGCTATGTATATCTAGGCTCCACTATCACCAACGCTGGAGGCTGCGAAGATGAGATCCGAAGACGTTGCGCCGTGACAAGATCCTCAGTTGAGAGGCTAACAAAGATTTGGAGAGACCGCAGAATAACCAAAAATACAAAAGTTCGGTTAATGAGATGCCTGGTCTTTCCAATCTTTCTGTATGGGGCTGAGACGTGGACGCTGAGGATGCAAGACCGTCGTAAGATCGACGCACTAGAAATGTGGTGTTGGAGACGTCTCCTCAGAATTCCGTGGACCGCGCACCGTACCAACATTTCGATCCTGAAAGAGCTCAACATCAAGGAGAGACTATCGTCAACAGTCCAATTACGAATCCTCAAATTCTTCGGGCACATCACTCGTAATGAGGACTCCATTGAGCGGTTGGTGGTGCAAGGGAAAGTCGAGGGCAAAAGATCTCGCGGACGATCTCCAACACGATGGACCGACCTCATAAAATCTGTTACTCACTCCAACTTAAATGCTTGCTCTCACTCTGCGAAACATCGTGCCACATGGCGTCGCATCGCGAGAGCATCGGTATCGCAGGATCCGACTGATGCATGA
Protein
MSRSYKSKSVRCDPSSDRRPKLSGNRGVKLVTGHGGAGDQAPHGNYATGRRTTKLQLRNDIRIGTWNVRGLIDEGKLHVLDHELERCNTVITGLSETHWKESGHRNLENHTIYFSGNELSSFAGVGIAIPKLWTESVLGYNPVSDRIITMKLSASPCALNIIQVYAPTSAATEEKIESFYNQLEACINNIPKREILMIIGDFNAKVGTTVLDVGLRNIVGHYGLGCRNSRGERLIQFAADNNLTIMNTAFKHHPRRLYTWTSPNGEHRNQIDYILIKTRWRSSITNAHTLPGADVTSDHQLLICNMRIRLRRPIIRKTVKRLEVIDRNSFVQSLQDMEQCWYENCSKEVSVDHLWQSTVQFIKDVVHESQPKKKSKKRQHWMSTETWDLIEKRRELKAGGVRMQELNVMSSAIQAACRRDRNTALQSICEEVERHSQNFETKDLHMKIRLITRQFKPKTWAIENASGDTVTEIKKIVSAWKDYCKSLFTDTTTKISMTYSEPSELEPMPLKDEVRAAINHLKRNKAVGFDEIPIETIKAMGEIGVDILHIICCRIWVTGVWPSDWSHSIFIPLHKKGSTKKCNNYRLISLVSHASKVMLHIINTRLQGYLSREIAPEQAGFVKGRGTREQLLVMRQIVEKAREFNISLYVCFVDFRKAFDTVKWWKLWLVLTEMGVPQHLVHTIRRLYEDGTAAVRVDSIDSERFSTQAGVRQGCILSPLLFNIYTEYIMRIVLDDWDKGISVGGRKISNLRYADDTTLLASTRDEIEVLLRRLETTALDFGLAINRDKTKMMIVDRANINQPEVQHIAGCEVVNSYVYLGSTITNAGGCEDEIRRRCAVTRSSVERLTKIWRDRRITKNTKVRLMRCLVFPIFLYGAETWTLRMQDRRKIDALEMWCWRRLLRIPWTAHRTNISILKELNIKERLSSTVQLRILKFFGHITRNEDSIERLVVQGKVEGKRSRGRSPTRWTDLIKSVTHSNLNACSHSAKHRATWRRIARASVSQDPTDA

Summary

EMBL
FJ265547    ADI61815.1    FJ265560    ADI61828.1    FJ265552    ADI61820.1    + More
FJ265546    ADI61814.1    FJ265557    ADI61825.1    FJ265553    ADI61821.1    FJ265548    ADI61816.1    GU815090    ADF18553.1    KZ150025    PZC74827.1    FJ265559    ADI61827.1    LBMM01007694    KMQ89503.1    GU815089    ADF18552.1    NWSH01001998    PCG69477.1    QIAP01000240    PYX61602.1    AHAT01008485    KF881087    AIJ27486.1    AHAT01017643    AAGJ04118689    AAGJ04161747    PDHN01000949    PGH37547.1    NEVH01002141    PNF42599.1    NEVH01023985    PNF17546.1    NEVH01015309    PNF27009.1    NEVH01002684    PNF41704.1    NEVH01022640    NEVH01008218    NEVH01005885    PNF18513.1    PNF34430.1    PNF38481.1    NEVH01013959    PNF28275.1    NEVH01003750    PNF40091.1    NEVH01019064    PNF23230.1    NEVH01013275    PNF29009.1    NEVH01025135    PNF15828.1    NEVH01014358    PNF27914.1    NEVH01019971    PNF22037.1    NEVH01018372    NEVH01014371    NEVH01011208    NEVH01002697    NEVH01002552    PNF23678.1    PNF27673.1    PNF31697.1    PNF41592.1    PNF42118.1    NEVH01007402    PNF35815.1    NEVH01023960    NEVH01010501    PNF17732.1    PNF32290.1    NEVH01014359    PNF27813.1    NEVH01019075    PNF22955.1    NEVH01017570    PNF23798.1    PNF27789.1    NEVH01017534    PNF24114.1    GFAH01000222    JAV48167.1    KF881086    AIJ27485.1    NEVH01017460    PNF24248.1    NEVH01021219    PNF19787.1    NEVH01012082    PNF31006.1    NEVH01020937    PNF20581.1    NEVH01005277    PNF39212.1    GDHC01007098    GDHC01001590    JAQ11531.1    JAQ17039.1    AHAT01016400    GGMR01018096    MBY30715.1    AHAT01010273    NWSH01000469    PCG76200.1    LSMT01000478    PFX17357.1    LSMT01001244    PFX12648.1    NEVH01021931    PNF19256.1    AFYH01236276    PYGN01000020    PSN57453.1    PYGN01000324    PSN48495.1    NEVH01016289    PNF26277.1    PYGN01000203    PSN51319.1    GBBI01004261    JAC14451.1    HE799691    CCH14900.1    NEVH01021921    PNF19488.1    NEVH01025668    PNF15041.1    KU311054    ALX81665.1    NEVH01017452    PNF24293.1    NEVH01013553    PNF28765.1    PYGN01001004    PSN38555.1    PYGN01000070    PSN55417.1    AAGJ04045270    PYGN01000219    PSN50892.1    AFYH01196306    NEVH01006721    PNF37211.1    NEVH01013215    PNF29703.1    PNF37310.1    NEVH01011186    PNF32183.1    NEVH01016335    PNF25462.1    PNF37115.1    NEVH01003500    PNF40666.1    NEVH01020865    PNF20863.1    GECL01001585    JAP04539.1    GGMR01020071    MBY32690.1    BN000794    CAJ00236.1    NEVH01021928    PNF19298.1    FJ265558    ADI61826.1    NEVH01017443    PNF24485.1    GBBI01004262    JAC14450.1    LBMM01005351    KMQ91586.1    FJ265555    ADI61823.1    GGFK01005184    MBW38505.1    FN356221    CAX83710.1    ABLF02066124    AJVK01001578   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR002138   Pept_C14_p10       
IPR000637   HMGI/Y_DNA-bd_CS       
IPR027124   Swc5/CFDP2       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
5HHL     E-value=0.000866784,     Score=105

Ontologies

Topology

Length:
1010
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.47318
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.00374
outside
1  -  1010
 
 

Population Genetic Test Statistics

Pi
1.025671
Theta
1.94266
Tajima's D
-1.686282
CLR
0
CSRT
0.0264486775661217
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号