SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00570
Annotation
PREDICTED:_uncharacterized_protein_LOC106708887_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.497 PlasmaMembrane   Reliability : 1.583
 

Sequence

CDS
ATGTCGGTGTCCTACATTCGCGGGAAGGTGACTAGTGAGCTCCGATGGTTCGCATCAGCTCATGCTTTGGTTGACAGAACAGATAGGGATGCGGCATTGCTCGATAGGGCGTCTCAGGTGCACGAACGGTTGGAGGTAGTGTACGATCGGTTGTCTGACCTCGTTGCTTTGGGGTCCGAAGTGGAGAAGGAGGTGATCCATGCCATCGGTCTTGACGTGGACCAGTGTCAGGAGTACGCTGATGCCATTCTGCAACGGGTGGCCGATATTAAGAAGCAGTCGGCTTCCGGTGGTAATGGAGGTTCGGGAACTTCGTCAGGCGTCATATCACGCCTCCCCTCCATCGACCTGCCGATCTTCCACGGTGATCTGAACGAGTGGGTCGGCTTTATAAATTTGTTTGACAGCCTGGTCCATGGTCGGTCGGACTTGACTGCCTCTTATAAGATGGCTCAGCTTCGGGGTGCTCTGCGAGGTGAACCTGGTGAATTGGTGGCACACTTGCCTATCACCAACGACAATTATGCGGTCGCACGCCAGATCCTGTTCGACCGATATCAAAATCAACGACGGTTGGTAGACGCTCAGCTGGCCAGGCTGTTTGCGATACCCAAACTTTCTCGGGCGTCCGATATCAGAACCGAGGTACTGAATCCAGTTACGGTGGCCACTAAGGCCTTGGGCAATTTGGGTCTACCAGTAGACCAATGGTCATATCTGCTCTTTTATATTGTTGCAGGTAGGCTGCCGGTTGAGGTGCTCACTCGCTTCGAGCAGCAGGACAACGCAGGTAGGGACGAACTGCCTACCCTGGCCAATCTGCTGGCATTTTTAGAAGCCGAAAGTCGCAGACACGAGATTATGCCACCACCCTCCTCCTCTGGGTCGCGTGTGCCGGCTTCCGGCCACGCCGTTTCGGTTGCTCAGAGGGGAGGGGGAGGGGATAAGAGGGGGCCGTCTCAACGACTGACTGCGCTCATGGCAGCGGTGGGAGGCTCACGGTGTGCCTTCTGTCATGAGAGCGGGCACGACGTAGCCGCCTGTCCGAGGTTCCGGTCGACGCGCATCAGGGGTAGACGCAACATCGTTGCCCAGCGGCGATGGTGCTTTTTTTGTTTTGGGCCGCACACGGCGAGCGTCTGTCCACAGCCACAATTGTGCTCTAATTGCGACGGTCGGCACCATGCCCTCCTGTGTCTGGAGTCTGCCGCCACTCCGAGGTCATCCGGACGCAGTCATCCAGCCTCGCCGACCGGTGAGCGCACCGGTCGTAGCCCTCGCCAATTCGGCGGCGTGGACCCTCGGGAAGAGGCTTCGCAGGGAGGCACCGGGTTAGAAGCTGTTTTACTTCCTACCGCTTCTGTTCGGGTGTTGGATTCGGATGGCAACACTGTGTTTGCTCGAGCTCTGTTGGATTCCGGCGCACAGGGCAGTATTATGTCGAGCAACCTTGCAGTACGGTTGGGCAATCCTATTTACAAGTCTTCTTATTCTATTCGTGGAGTGGGCAATGTTAGAATTTCGGACGTGATCGGTCACACTTCATTTATTTTCTCATCGAATCCCAACCCTCGCTTACAGTTTAGAGTCTCAGCTTTGGTGATGCCTGAGGTGATAGGTCGTCACCCTCCGGTGAAGGTAAACAGTTACATACGGTCATTGACTTCAGACTTACGGCTAGCGGACCCCAAGTTTGACACCCCGGGGCCAGTAGACGTACTACTTGGGGCGGATGTACTAGGGAAGCTGCTCCTGACTGGGAAGCGCGTTCTTCATGCGGAGGGTTTGGTTGCAATGGACACAAAATTAGGGCATGTATTGTTGGGTCCTGCGTTCCGGCCGGTCGCTGCGAGGAAATCGGACAATTTTCTGGTCGGGTCTACGCTTTCGGAAGTAGTCCAACGGTTTTGGGAACTAGAAGAACCTCCTACAGCTTATCGAGTTAACCCGGATGAGGAGGAATGTGAGCTGTTTTACCAGAATAATACGGGTCGTCTCTATTCGGGCCGGTTCTTGTTAAGACTTCCTTTTCGGGCGAATCGCCCACTGCTAGGCAGTTCGAGGAAGGCAGCAGAGACTAGACTTTTGTCAATGGAGAGACGCATGAGGCGCGACGCGGTGTTCCGGCAGAAATATGTAGAGTTTATGCGGGAGTATGAATCCTTAGGTCACATGTCGGTTTCCAAGGTAGATTGGAGTGCTACAGAGCACTGTTTCCTGCCTCATCATGCGGTTTTGAAAACTCCTAACGGGAAAATTAGGGTCGTGTTTGACGGTTCGGTCACGACCTCCTCCGGCGTCTCGTTAAATCAGTGTCTCCATTCGGGTCCAAAGCTGAACCGGGACATTTCAGACATACTGACGAGCTTCCGCCGGCACCAGATCGTTTTCGTGGCAGACATCCGTATGATGTTCAGGCAAACGGTGATTCATCCGGAGGATAGGCGGTATCAACTCATTCTCTGGCGTGAAAGCTCAGATGAGCCCATAAAAATTTATGAACTGAACACGAACACTTACGGGTTGCGGTCGAGTCCATATTTGGCGGTTCGTTCTTTGCGGGAGCTGGCAGTGAGGGAACGGTTGCACTACCCTCGTGCTGCGGACATTTTGGAACGGGACCTATATGTCGATGACGTATGTACGGGCGCCGACAGTGTCGAAGAGGCCTTATCACGCAAGGATGAACTGATCCGCCTTTTGAGCAGGGGCGGGTACGAGTTGAGAAAATGGCTGTCTAACTGTCCTGAGTTGTTGACTGGTTTGCCAACGGAGTATCAACAGGATCCCCATCTTTTCGAGAATGTCGATAACCCTAACATGCTGTCGGTCCTAGGGATTCAATATCGTCCGATTCAAGACGAATTTACCTATCGGGTGGAGTTGGAAAATCCAAAGGTATGGTCTAAGCGAACGGTGCTTTCCACAATTGCTCGAACCTTCGATCCAAACGGTTGGATCGCTCCTGTCACTTTTCTCTTAAAGTGCTTCATGCAGCGACTGTGGTCTGCTAACCTGTCATGGGACGAGGGGATTGCTGGTGACCTATTGAAGGATTGGTTGAACTTTTTCTCGTCTCTTCCTGATATTAACCACATGTCAATACCTCGGAAGCTGGTTCCTGCGGGCAAATACAAGGCGTCTCTCCACGGGTTTTCGGATGCCTCGGAACGCGGATTCGCAGCTGCGGTATACTTGCGAACGGTTTCTTCAACTGGAAGGGTTGATATACGGTTGGTGTTAGCTAAGAGTAAGGTCGCTCCGCTTCGGACACGCATGACGATTCCGAAGCTCGAGTTGTCTGGTGCCGCTCTACTGACTAGGTTGTTAAACCATACAGCTACTAGCTTACGGTCGGTTATTGATTTAGAAAACACTGTGTATGCTTGGACAGACAGCCAGATAGTGTTGTGCTGGTTGAAGGCTTCGGTTCATACACTTGAAGTTTTCGTGGCCAACCGTGTCTCCCAGATTCAAGGATCTGAGGTCCCTCTAACATGGAGACACGTGCCTGGTGAGCTCAATCCGGCGGACTGCGCTTCTCGGGGATGCTTAGCATCGGAAATAGTTGATCATCAGTTATGGTGGGGTCCCCAGTGGCTCACAATGAAGCCTTCTCAGTGGCCACCCTCTCGCATAGGAGTTCCTCCAGGTCTCGTGGCTGCACCGGCGCAGTTCGAGGATCGAGGAGTGATTCAGGGGTTGGATTTGGATCTGCTCATCAACCGTTATAGCTCCTTGGACAAGCTGGTTAAGGTTACCGCCTGGATTTTGAGGTTTATTCGGAATTGTCGTTTGTCGGTGTCTCAACGCAATATGACACCTGTTGTGTGTCCCATCGAGCGGAAGAAGGCGCTGCTGAAATTAATTGAAGTTGTGCAAGCCACCAGCTTTCATTCAGAATTGAAGGCGCTAAGGACTGAGCGCCCTAAGCTTCGTGGAGCTATCGCTCGTCTTAGCCCCTTTGTAGACGGCCAGGGGTTGATTCGAGTAGGAGGTCGATTAAGTAACTCCAATTTACCTTATTCGGCGCGCCATCCTCTTTTACTTCCCAAGAAAAGCCAGTTAGTTGACCTGTTGGTGATGGATCGCCACATCGCAAATTCGCATTCCGGTTGCAATGCGCTGTTGGCATCCCTCCAGAGGGAATTTTGGATTCTGTCAGGGCGTCGTACGGTTCGGAGCGTCCTTTTCCGGTGTTTACCCTGTTATCGGCTTAAGGCGTCTACGATGCAGCCTCAGATGGGAGATCTGCCTCCAGACAGAGTGAAGAAGATGAGGCCGTTTTCTGGAGTTGGTACGGACTTCGCTGGGCCTTTCATGATCAAGGCTTCACGTTTGCGGAATGTTAGGTTAATTAAGGCTTATCTGTGCGTCTTTGTCTGCCTTTCAACCAAAGCTGTACATCTTGAAGTTGTTGCCGACCTTACAACTGAAGCCTTTATTGCGAGCTTGGATAGATTTGTGTCCCGTCGAGGCTTACCCGAATTGATACGCTCCGATAACGGAACGAATTTTGTAGGTGCGGACCGTTACTTGCGGGATGTAGTAAATTTCTTGAACAATAACCAGGTGGATATTGAAACGGCCCTCTCTCGTCGCGGTATTCGGTGGACCTTCAGTCCTCCAGGATGCCCCCACTGGGGTGGAATTTTCGAGGCAGTAGTAAAATCGGCTAAGACTCACTTGATGCGCGTGATAGGGCAAACCTCGCTCACCTTTGAGGAGTTAACCACGGTATTTTGTAAAATTGAAGCGGTACTTAATTCACGGCCGTTGTGCCCGCTCAGTTCAGACCCGAATGACTTGGAGTCGTTAACTCCAGGCCATTTCTTGATAGGACAGCCACTCAATGCGTTGCCGGAGTATCCCCTCTCGGATATCAAGCCTGGACGGTTGAGGCGATACCAGATGTTGCAGCAGATGTCCCAAGATTTTTGGAAACGTTGGTCCCTTGAGTATTTACATCTGCTCCAGCAGCGCTTTAAGTGGACGGATAGAACCAGTCCCCCTCACGTCGGTGACCTTGTGTTGGTTAAGGATGCTAACCTGCCGCCACTGCGTTGGCGTAGGGGGCGCATTGTTAATCTGTTTCCCGGTAAGGATGGAACCCCTCGGTCTGCAGAGGTTCTGGTCGGGGACTCTGTTCTCAAACGAGCGGTCACAACGTTGTCCCGGCTGCCAGTTGATTAG
Protein
MSVSYIRGKVTSELRWFASAHALVDRTDRDAALLDRASQVHERLEVVYDRLSDLVALGSEVEKEVIHAIGLDVDQCQEYADAILQRVADIKKQSASGGNGGSGTSSGVISRLPSIDLPIFHGDLNEWVGFINLFDSLVHGRSDLTASYKMAQLRGALRGEPGELVAHLPITNDNYAVARQILFDRYQNQRRLVDAQLARLFAIPKLSRASDIRTEVLNPVTVATKALGNLGLPVDQWSYLLFYIVAGRLPVEVLTRFEQQDNAGRDELPTLANLLAFLEAESRRHEIMPPPSSSGSRVPASGHAVSVAQRGGGGDKRGPSQRLTALMAAVGGSRCAFCHESGHDVAACPRFRSTRIRGRRNIVAQRRWCFFCFGPHTASVCPQPQLCSNCDGRHHALLCLESAATPRSSGRSHPASPTGERTGRSPRQFGGVDPREEASQGGTGLEAVLLPTASVRVLDSDGNTVFARALLDSGAQGSIMSSNLAVRLGNPIYKSSYSIRGVGNVRISDVIGHTSFIFSSNPNPRLQFRVSALVMPEVIGRHPPVKVNSYIRSLTSDLRLADPKFDTPGPVDVLLGADVLGKLLLTGKRVLHAEGLVAMDTKLGHVLLGPAFRPVAARKSDNFLVGSTLSEVVQRFWELEEPPTAYRVNPDEEECELFYQNNTGRLYSGRFLLRLPFRANRPLLGSSRKAAETRLLSMERRMRRDAVFRQKYVEFMREYESLGHMSVSKVDWSATEHCFLPHHAVLKTPNGKIRVVFDGSVTTSSGVSLNQCLHSGPKLNRDISDILTSFRRHQIVFVADIRMMFRQTVIHPEDRRYQLILWRESSDEPIKIYELNTNTYGLRSSPYLAVRSLRELAVRERLHYPRAADILERDLYVDDVCTGADSVEEALSRKDELIRLLSRGGYELRKWLSNCPELLTGLPTEYQQDPHLFENVDNPNMLSVLGIQYRPIQDEFTYRVELENPKVWSKRTVLSTIARTFDPNGWIAPVTFLLKCFMQRLWSANLSWDEGIAGDLLKDWLNFFSSLPDINHMSIPRKLVPAGKYKASLHGFSDASERGFAAAVYLRTVSSTGRVDIRLVLAKSKVAPLRTRMTIPKLELSGAALLTRLLNHTATSLRSVIDLENTVYAWTDSQIVLCWLKASVHTLEVFVANRVSQIQGSEVPLTWRHVPGELNPADCASRGCLASEIVDHQLWWGPQWLTMKPSQWPPSRIGVPPGLVAAPAQFEDRGVIQGLDLDLLINRYSSLDKLVKVTAWILRFIRNCRLSVSQRNMTPVVCPIERKKALLKLIEVVQATSFHSELKALRTERPKLRGAIARLSPFVDGQGLIRVGGRLSNSNLPYSARHPLLLPKKSQLVDLLVMDRHIANSHSGCNALLASLQREFWILSGRRTVRSVLFRCLPCYRLKASTMQPQMGDLPPDRVKKMRPFSGVGTDFAGPFMIKASRLRNVRLIKAYLCVFVCLSTKAVHLEVVADLTTEAFIASLDRFVSRRGLPELIRSDNGTNFVGADRYLRDVVNFLNNNQVDIETALSRRGIRWTFSPPGCPHWGGIFEAVVKSAKTHLMRVIGQTSLTFEELTTVFCKIEAVLNSRPLCPLSSDPNDLESLTPGHFLIGQPLNALPEYPLSDIKPGRLRRYQMLQQMSQDFWKRWSLEYLHLLQQRFKWTDRTSPPHVGDLVLVKDANLPPLRWRRGRIVNLFPGKDGTPRSAEVLVGDSVLKRAVTTLSRLPVD

Summary

EMBL
GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    LNIX01000007    OXA51795.1    + More
GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    ABLF02005684    LBMM01010405    KMQ87487.1    LNIX01000016    OXA46198.1    ABLF02030698    ABLF02030705    ABLF02030709    LBMM01008464    KMQ88855.1    ABLF02054908    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    LNIX01000036    OXA39969.1    ABLF02041614    LBMM01009888    KMQ87813.1    GGMR01010723    MBY23342.1    ABLF02039606    ABLF02021785    ABLF02008636    ABLF02065931    GGMR01002024    MBY14643.1    KK114194    KFM61875.1    ABLF02030854    ABLF02067347    ABLF02035780    ABLF02008594    LBMM01007859    KMQ89359.1    GGMS01010524    MBY79727.1    LNIX01000002    OXA60848.1    GEZM01060254    JAV71154.1    LBMM01009202    KMQ88311.1    ABLF02025193    LBMM01006490    KMQ90572.1    GGMR01013370    MBY25989.1    LBMM01009964    KMQ87756.1    LBMM01010417    KMQ87475.1    LBMM01009898    KMQ87805.1    LBMM01009746    KMQ87900.1    ABLF02006304    ABLF02036268    OXA59522.1    ABLF02028666    ABLF02066713    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GGMS01012379    MBY81582.1    GGMR01006575    MBY19194.1    ABLF02015138    GGMR01016460    MBY29079.1    GEHC01000869    JAV46776.1    LBMM01009645    KMQ87967.1    GGMR01002421    MBY15040.1    ABLF02041650    GEZM01085145    GEZM01085143    JAV60187.1    GGMR01002187    MBY14806.1    ABLF02022040    ABLF02056888    GGMR01020500    MBY33119.1    LBMM01009688    KMQ87939.1    GEBQ01000825    JAT39152.1    GBRD01007977    JAG57844.1    GGMR01014351    MBY26970.1    GFTR01008874    JAW07552.1    LNIX01000005    OXA54454.1    GGMR01005823    MBY18442.1    ABLF02006784    LNIX01000018    OXA45284.1    ABLF02023842    ABLF02028949    ABLF02058391    ABLF02036131    ABLF02041527    ABLF02064049    GGMR01018506    MBY31125.1    GEZM01066272    JAV68024.1    GBHO01044316    JAF99287.1    ABLF02041863    GGMS01006636    MBY75839.1    GBBI01004479    JAC14233.1    GEZM01054765    JAV73413.1    ABLF02041670    LNIX01000069    OXA36894.1    LBMM01009551    KMQ88039.1    GALX01004947    JAB63519.1    ABLF02067195    GGMR01004029    MBY16648.1    ABLF02041505    GGMR01014306    MBY26925.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    GEHC01000870    JAV46775.1    KQ460211    KPJ16510.1    LBMM01008324    KMQ88972.1    GGMR01009860    MBY22479.1    GEBQ01015458    JAT24519.1    GFTR01008866    JAW07560.1    GBBI01004211    JAC14501.1    GAMC01003146    JAC03410.1    GBHO01007689    JAG35915.1    GEHC01000864    JAV46781.1    KQ458793    KPJ04955.1    NWSH01001945    PCG69607.1    GEZM01054789    JAV73399.1    CR954257    CAJ14165.1    ABLF02041590    GBBI01004410    JAC14302.1   
Pfam
PF18701   DUF5641        + More
PF05380   Peptidase_A17
PF03564   DUF1759
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF09337   zf-H2C2
Interpro
IPR001584   Integrase_cat-core        + More
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001878   Znf_CCHC       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR000477   RT_dom       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
IPR015416   Znf_H2C2_histone_UAS-bd       
IPR000727   T_SNARE_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
Gene 3D
PDB
5UOQ     E-value=0.079104,     Score=90

Ontologies

Topology

Length:
1730
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01679
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00063
outside
1  -  1730
 
 

Population Genetic Test Statistics

Pi
11.605334
Theta
13.82121
Tajima's D
-1.157492
CLR
0.586906
CSRT
0.106144692765362
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号