SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00569
Pre Gene Modal
BGIBMGA012242
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.151 Nuclear   Reliability : 1.133 PlasmaMembrane   Reliability : 1.688
 

Sequence

CDS
ATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGTGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTTAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCCAGTAGAAACAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTCTTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGTATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGTCAATCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATTTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTTCAATCTCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATACAGAAATACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTAGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTCGCACTAGACGCCTTCAGCTCTAGGAGCAGGCTTAGGGACCTCGGTCTTTACCTACATAACGTAGTAGCTGCGAACAATTTGCGAGAACGTGTCCCCTACCAATGGTATTGTGTTTGGGCCTGGGGCGCTCCCGTTGTTATAACATCAATTTGGACTATATTAACAGCTCTTAAATATCGCGGTGAAAAAGTTCAAACGAAAGCGGTGCGGGCGGCTCTGGTACTCTTACCTCTGCTAGGAATTACAAACATTATGAATATGTTCGAAGCTCCTCTGAGCTCTGATCCGATCCGGTTTGCCGTATGGAGTTACTTAACACATTTCTTAAGATCTTTTCAAGGCTTCTTCATCGCGCTAATATACTGTTTCTTAAACGGCGAGGTGAAGCAGTGCCTGTCGAAGGCATACACCAACTACATGGCGGAGAGGGCACTCCTGGTTCGGCAGAATGCCATTTGTGTACCATCTATGGATGAAGAGCCAGCTAAAGAAAAAAAGGCAAGCTATCTGTCTTGCTGCTTCCCAAGCAAGACTGAAAAGCGAACAAGCAAAGACTACCGGGCTTGTGCTTTGGATTTAAACAAGGATGAAGAGCCAGCTAAAGAAAAAAAGGCAAGCTGTCTGTCTTTCTGCTTCCCAAGCAAGACTGAAAAGCGAACAAGCAAAGACTATCGGGCTGGTGCTTTGGATTTCAACAACACGGCCCGCGCGCGTCGTCTCGAATTGCACATGGTGAGCAATTCCCAATTGCCTACTCCACTACAATCGCCATGTCCTGCTGTGGTTCGTAGACAGATGGAATTGCAGGAGCTCAAACAATCCACTCCGCTAATTCCCCGTCGGCATATCGTGTCGGCCCCGAAGAGGGCCGTAAGGATTCCGTTTGATGACGACGATGAGGCCGTCACTAAGGAGCCCTTCTCGTGCTACGCTGATACTCTTGAAATGGCCGAACTGGGTGCGGTAAGCCCCTGGGTTTACAGGCGACGATGCTCGCCACCAGAGATGGGGATATTCGATACCTGCAGCTTGACGCGCGGCTCGTGCGATGAGCAGCCTCCTATTCATATTGAGAGGTGTATATACGCAACTAGGGCTATCGTACCGAGCTCACCCTATGTGGCTGACACTGATGCTCGTGAAGTCGGCTCGTGCGATGAGCAGTCTCCTGTTCATATTGGGGGCTATATACACGCAACTAGGGTTATCGTACCGAGCTCACCCTATGTGGCTGACACTGATGCTCGTGAAGTGTCCAAATAA
Protein
MSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFSQSIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSRSRLRDLGLYLHNVVAANNLRERVPYQWYCVWAWGAPVVITSIWTILTALKYRGEKVQTKAVRAALVLLPLLGITNIMNMFEAPLSSDPIRFAVWSYLTHFLRSFQGFFIALIYCFLNGEVKQCLSKAYTNYMAERALLVRQNAICVPSMDEEPAKEKKASYLSCCFPSKTEKRTSKDYRACALDLNKDEEPAKEKKASCLSFCFPSKTEKRTSKDYRAGALDFNNTARARRLELHMVSNSQLPTPLQSPCPAVVRRQMELQELKQSTPLIPRRHIVSAPKRAVRIPFDDDDEAVTKEPFSCYADTLEMAELGAVSPWVYRRRCSPPEMGIFDTCSLTRGSCDEQPPIHIERCIYATRAIVPSSPYVADTDAREVGSCDEQSPVHIGGYIHATRVIVPSSPYVADTDAREVSK

Summary

Uniprot
ProteinModelPortal
PDB
6NBI     E-value=0.000592573,     Score=105

Ontologies

Topology

Length:
820
Number of predicted TMHs:
3
Exp number of AAs in TMHs:
62.4118900000001
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.01989
outside
1  -  434
TMhelix
435  -  457
inside
458  -  468
TMhelix
469  -  488
outside
489  -  502
TMhelix
503  -  525
inside
526  -  820
 
 

Population Genetic Test Statistics

Pi
18.396741
Theta
16.465506
Tajima's D
-1.716837
CLR
0.011839
CSRT
0.0346982650867457
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号