SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00565
Annotation
transposase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.396
 

Sequence

CDS
ATGGATGAGAAATTTTTTACAATTGAGCAACATTTTAACAAACAAAATGACCGTATTTATGCTCAAAGCTCTAAGAAAGCTTCCCAATTAGTCGACAGAGTGCAACGTGGGCACTATCCGACTTCAGTGATGGTTTGGTGGGGTATTAGCTATGAAGGAGTGACTGAGCCATACTTTTGTGACAAAGGTATCAAAACATCTGCACAAGTGTATCAAGATACTATTCTTGAGGAGGTAGTGAAGCCCCTTAACAACCCCATGTTCAATAATCAAGAATGGTTCTTCCTGCAAGACTCGGCACCAGGTCATAAAGCTCGGTCTACGCAGTCTTGGTTGGAAACGAAATTTTCGGACTTCATCAGAGCTGAAGACTGGCCGTCGTCTAGACCCGATCTTAATCCGCTGGATTATGATTTATGGTCAGTTTTAGAGAGTACGGCTTGCTCTAAACGCCATGATAATTTGGAGTCCCTTAAACATTCCGTACGATTGGCAATGAAAATTTTTCCCATGGAAAGTGTGTGTGCTTCTATTGATAACTGGCCTCAACGTTTAAAGGACTGTATTGTAGCCAATGGAGACCACTTCGAATAA
Protein
MDEKFFTIEQHFNKQNDRIYAQSSKKASQLVDRVQRGHYPTSVMVWWGISYEGVTEPYFCDKGIKTSAQVYQDTILEEVVKPLNNPMFNNQEWFFLQDSAPGHKARSTQSWLETKFSDFIRAEDWPSSRPDLNPLDYDLWSVLESTACSKRHDNLESLKHSVRLAMKIFPMESVCASIDNWPQRLKDCIVANGDHFE

Summary

EMBL
U47917    AAB47739.1    JF779677    AEO90418.1    AB363006    AB363010    + More
AB363014    BAG15923.1    BAG15924.1    AF461149    AAN06610.1    AB473770    BAH20555.1    AB363018    BAG15926.1    AB363028    BAG15927.1    LNIX01000030    OXA41211.1    JARK01001411    EYC06502.1    JOJR01000583    RCN36166.1    UYSL01019905    VDL71189.1    KQ459680    KPJ20472.1    JOJR01000015    RCN51257.1    HE601413    CAS00486.1    KA646003    AFP60632.1    CAVP010059404    CDL95787.1    JARK01001345    EYC27589.1    JARK01001418    EYC05389.1    JARK01001601    EYB87313.1    JARK01000176    EYC41234.1    PDUG01000005    PIC23776.1    JARK01001337    EYC34439.1    DS268492    EFP11674.1    JARK01000255    EYC39473.1    DS268428    EFO94379.1    DS268466    EFP06959.1    DS268606    EFO93488.1    DS268508    EFO83264.1    PIC28734.1    PDUG01000006    PIC20538.1    DS268679    EFO98285.1    JARK01000059    EYC44525.1    PDUG01000012    PIC13506.1    KX931010    APL98300.1    DS268673    EFO98001.1    UZAH01001595    VDO19836.1    JARK01001658    EYB84158.1    DS268612    EFO94085.1    EFP11689.1    DS268539    EFO88027.1    DS268747    EFP00909.1    DS268421    EFO88618.1    DS268525    EFO85497.1    UYSL01019770    VDL69590.1    DS268545    EFO88382.1    PIC29926.1    DS268565    EFO90304.1    PDUG01000001    PIC51673.1    LFYR01002220    KMZ56176.1    PDUG01000004    PIC32571.1    UYSL01020440    VDL74616.1    UZAH01036445    VDP45493.1    PIC32570.1    UZAH01029309    VDP05368.1    KN728435    KIH63782.1    CH902625    KPU75512.1    HE601187    CAR99265.1    UZAH01000669    VDO19161.1    JARK01001499    EYB95145.1    UZAH01026445    VDO80847.1    HE601047    HE600964    CAS00660.1    CAS01013.1    HE601507    CAR99239.1    KN769991    KIH46151.1    PIC24955.1    JARK01001390    EYC10681.1    PIC53815.1    HE600908    CAR99632.1    UZAH01027257    VDO90094.1    UZAH01031030    VDP13493.1   
Pfam
PF13358   DDE_3        + More
PF00292   PAX
PF00250   Forkhead
PF00001   7tm_1
PF13936   HTH_38
Interpro
IPR009057   Homeobox-like_sf        + More
IPR038717   Tc1-like_DDE_dom       
IPR036388   WH-like_DNA-bd_sf       
IPR001523   Paired_dom       
IPR036906   ATPase_V1_fsu_sf       
IPR036390   WH_DNA-bd_sf       
IPR001766   Fork_head_dom       
IPR030456   TF_fork_head_CS_2       
IPR017452   GPCR_Rhodpsn_7TM       
IPR000276   GPCR_Rhodpsn       
IPR025246   IS30-like_HTH       
SUPFAM
SSF46689   SSF46689        + More
SSF46785   SSF46785       
Gene 3D
PDB
5CR4     E-value=7.15437e-07,     Score=123

Ontologies

Topology

Subcellular location
Nucleus  
Length:
197
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00550999999999999
Exp number, first 60 AAs:
0.00535
Total prob of N-in:
0.06584
outside
1  -  197
 
 

Population Genetic Test Statistics

Pi
1.026991
Theta
1.889975
Tajima's D
-1.28833
CLR
0
CSRT
0.0810459477026149
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号