SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00561
Annotation
PREDICTED:_uncharacterized_protein_LOC106713896?_partial_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.837 PlasmaMembrane   Reliability : 1.528
 

Sequence

CDS
ATGTTTTCTGTGTTTCAGACATTGTGCCCGACCGTGAATGTTTCGACACAACGACTGTCAGATCAGGTGAGGGCTATCCAGCGGCTTAGGCTGTTGGACCAGTCTCTTCTTGATCGACTACGCTACGAAGCGTTACCTGTTCCCATCGAACCACAAGAAAACCAAGTGGTAACTGACACCGTCGCCCCAATAATACAACACGATGAGGAAATTCAAGAACAGGTTTGTGCAAGTAACCAGGACTATGAGCGTTTGAGTAGTGCTTTGGAGGATTCTATTCAAGAATATAGGTTAGTTTCCTCCTGCTCTAGACCACGATTACCACGTTTGCCTATGCATAGACGTAATGTTTCGCTTGTAGGGGCCCTGGACTCTATTCTAAAACCCTATTTAGAATCAAGTACGGATCTAATTGATACGCACTCACTTCTGTACTGCGGTGCGGTAGCGGTTTGTCGTGTAGCTGAGGTTAAGTCTCCAAATTTAACCCAGACAGCCTATCGACCCCCTACTAAACCACAATGGCAGTGCAGAATTGAGAAGCGAATTGATAGGGCCAGGATTCTTATAGCAAAGCTTATGTGCTTCCAGAAAGGAAATACTCGTCCACGGGTTATGTGTTTCGTCGATCAGGCTTTTGCCGGAACTGGAATAAGCTCAAACGAATACATGACCTGTATTATTGAGCGCATAGACTTCTGGAAGCAAAAAGTTTATGCTTGGGCAAGCCGTATTCGTCGGTATCGTCTAAGATCTGAGCGATACCATTTGAATAGAGTTTTCCAAAGAGATCAAAGAAGTGTATACAGAAACTGGGAGTTGTCTCAATCCCAAGTGACCAATGACCCATACAATGTCAATGAAGAGGACATGTCAACATTTTGGAAAAATATTTGGTCGATACCCATTGGTCACTCTGAAGGGGAATGGATACAAACTGTCAGGCGGGAATGTGAATCGTATAAAGAGATGGATCCAATAACAATATCCGCCATTGATGTTTCTCGTGCAGTACGTTCGATGCCAAATTGGAAAAGTCCGGGACCGGACGGACTACACAGTTACTGGATCAAGTGGATCCGAAGTTCACATGAACGCCTGGCAGCTCAATTCCAACAGGCCCTTGAGATGGGATCACTCCCAGATTTCATGACATCTGGTATCACTTATTTGATTTATAAATCTGGCAATACCTCGGATCCCAAGAATTACAGACCAATTACATGCTTACCTACCATCTATAAGCTACTTACATCCATTTTGAGAATCAAAATTCAAAACCACATTTTTAATAATAACATTTTATCACCTAATCAGAATGGATGTAAGGCTGGGTCTCGAGGTACAAAAGATTTGCTACTCATTGACATGACCATTACTCAACAAGTTCGGCGGGGTAAGAGGAACGTTCATATGGCTTGGATTGATTATAAGAAAGCGTATGACTCTGTGCCTCATACATGGCTAATGAGAGTTTTAGAGCTATATAAAATAAATCCCATACTATGCTCCTTTCTTAGCTCATGCATGGGTCAATGGTCTACGTTTCTTAGTCAACCAGGTCAGATGACTTCTTCTGCTGCCCCGAATTTAATAAGGATTAAGCGGGGTATCTTTCAGGGCGACAGTCTGAGTCCTTTGTGGTTTTGTTTGGCGCTTAATCCTTTAAGTACATTACTTAAAGATTCAACGCTAGGCTACCGACTTCGCAGAGGAGCTGAGGCTATATCACATCTCTTGTTCATGGATGATCTCAAATTATTTGCTTCCAAAAAACCAGACTTAATGAGTTTACTAAAAATAACCGACAGTTTTAGTAAAGCCATTGGGATGGAATTTGGTGTTGATAAATGTGCGTTCATAGATGTACAGAGAGGTAAAGTTGTAAGCTCAGATTGCTTACTACTTAACCATAGTGTGGTCCTCAAGTCTCTTTGTGAATCGGAAACTTACAAGTACCTTGGTATGTTTGAAGTGCTGAATATTGTTGACGCAGATATGAAACAATCGTTTAGAGATCGGTTTTTTGGTCGTCTTATAAAGGTCTTAAAAAGCCATTTATCAGGCGGAAACAAAATCCGAGCGTTTAATGGTTGGGTCATGCCTATGTTAACATATTCCTTTGGCATACTAAGGTGGACGCAATCAGAGCTGGACGTACTGGACAGAAAAGTCAGGCGATTGTTAACGGCATACAGAATGCATCATCCACGTTCGTCTGTAATGAGGTTGTATATTCCTCGGAAATGTGGGGGTCGTGGTATTTTGAATGCCAAGGATCTACATAACCGAGAGATATACAACCTTAGGGAATATTTCCTTAAGATGAACGTGAATATGTATCGGGATGTCGTTGCAGTCGATAAGGGGCTAACTCCGCTATCCTTAGCTAACGGGAATTGGAAGAGGCTGAAGGTAGAGGGTATTTCAGATCGCATAACCGTATGGAGGAGCAAGGAGTTACACGGTAGGTTCTACCGGGCTCTCACAGGGCCTGATGTAGACCAATTAGCTTCCGTGGCCTGGTTAAGATTCAGTAACCTCTTTGGGGAAACTGAAGGTTTTATCTTTGCAATTATGGACGAAGTTATCATGACGAACAACTACCGGAAATATATACTAAAGGATGGGACGGTCGACATTTGTCGGGCATGCCACCGTCCGGGAGAGTCTATTAGACATATTGTTTCTGGCTGTTCTCGGTTTGCTAACGGCGAGTACTTGCATAGACATAACCAAGTGGCTAGGATTATCCATCAACAACTTGCTCTGAAATATGGTTTTCTTGATTCTGCTGTACCTTATTACCAATACCAACCTCAACCAGTTCTTGATAATGGTCATGTTACGCTCTACTGGGACCGATCTATTATCACGGATAGGTATATTGTTGCCAATAAACCTGATATTGTGATAATAGATCGATCTGCGCGTCGAGCAGTGTTGGTTGATGTCACCATTCCTCATGACGAGAACCTCGTGAAGGCAGAAAAGGACAAATTAATAAAATATTTAGACCTGGCCCACGAGACTACCGCCATGTGGCATGTTGATTCAACCATCATTGTTCCAATAGTTGTATCGGTACACGGCTTGATAGCGAAAAGTTTCGATCAACATCTTAAGAAACTTTCGTTATCCAGCTGGGTTAAGGGCCTAATACAGAAAGCAGTTATCCTCGATACTGCACGCATTGTGAGGAGGTTTCTCACTCTGGAGTCCTAA
Protein
MFSVFQTLCPTVNVSTQRLSDQVRAIQRLRLLDQSLLDRLRYEALPVPIEPQENQVVTDTVAPIIQHDEEIQEQVCASNQDYERLSSALEDSIQEYRLVSSCSRPRLPRLPMHRRNVSLVGALDSILKPYLESSTDLIDTHSLLYCGAVAVCRVAEVKSPNLTQTAYRPPTKPQWQCRIEKRIDRARILIAKLMCFQKGNTRPRVMCFVDQAFAGTGISSNEYMTCIIERIDFWKQKVYAWASRIRRYRLRSERYHLNRVFQRDQRSVYRNWELSQSQVTNDPYNVNEEDMSTFWKNIWSIPIGHSEGEWIQTVRRECESYKEMDPITISAIDVSRAVRSMPNWKSPGPDGLHSYWIKWIRSSHERLAAQFQQALEMGSLPDFMTSGITYLIYKSGNTSDPKNYRPITCLPTIYKLLTSILRIKIQNHIFNNNILSPNQNGCKAGSRGTKDLLLIDMTITQQVRRGKRNVHMAWIDYKKAYDSVPHTWLMRVLELYKINPILCSFLSSCMGQWSTFLSQPGQMTSSAAPNLIRIKRGIFQGDSLSPLWFCLALNPLSTLLKDSTLGYRLRRGAEAISHLLFMDDLKLFASKKPDLMSLLKITDSFSKAIGMEFGVDKCAFIDVQRGKVVSSDCLLLNHSVVLKSLCESETYKYLGMFEVLNIVDADMKQSFRDRFFGRLIKVLKSHLSGGNKIRAFNGWVMPMLTYSFGILRWTQSELDVLDRKVRRLLTAYRMHHPRSSVMRLYIPRKCGGRGILNAKDLHNREIYNLREYFLKMNVNMYRDVVAVDKGLTPLSLANGNWKRLKVEGISDRITVWRSKELHGRFYRALTGPDVDQLASVAWLRFSNLFGETEGFIFAIMDEVIMTNNYRKYILKDGTVDICRACHRPGESIRHIVSGCSRFANGEYLHRHNQVARIIHQQLALKYGFLDSAVPYYQYQPQPVLDNGHVTLYWDRSIITDRYIVANKPDIVIIDRSARRAVLVDVTIPHDENLVKAEKDKLIKYLDLAHETTAMWHVDSTIIVPIVVSVHGLIAKSFDQHLKKLSLSSWVKGLIQKAVILDTARIVRRFLTLES

Summary

Pfam
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR001611   Leu-rich_rpt       

Ontologies

Topology

Length:
1074
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.04532
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  1074
 
 

Population Genetic Test Statistics

Pi
10.356167
Theta
10.994439
Tajima's D
0
CLR
1.155602
CSRT
0.375231238438078
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号