SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00541
Pre Gene Modal
BGIBMGA012989
Annotation
Yokozuna_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.676
 

Sequence

CDS
ATGTTAGCCAGTCTGGATAAAGTTTTTGAGAGAAAAGGTATTTTCACTAAATTACACTTGCGAAGAAAGTTATTGTCTCTTAAGCTGAGGGATGATAAATTGGAAGACTATTTCATGAGATTTGAAAGTCTGATTAGAGAAATAGAAAATATTGATAAAAAGATGGATGAAGAAGTTAAAATATGTTATTTGCTGACGGGTATGTCGGAAAAGTACAACACAGTGATAACTGCTATTGAAACAATGTCTGCAGATAAAATTGACATGGAGTTTGTCAAGGCTCGGTTATTGGACGAAGAACTCAAACTGAATAATAAAGGTGAAGAGTATAATGATACAAAGAATGATGTAAGTTTTACTGCCTCAAGTGTAGAATGTTATCGTTGCCACAAAAAGGGCCATTTTGCACGTGAATGTAGAAGCAGAGGTCGTGGCTATTCAAGGAGAAACATTAATAATAAAGGTATATGTGGTAAAAACAGAACTGGAGAACAAAATAATATGACAGAAAGCATCCCAGAGAATAAATATAATTTTCTAGCAATAACGGAGTGTAATCTAAGTAGAGAAGACAAATTTATAGAATTTATAATAGATTCAGGAGCTACAGAAAATCTTATCAAGGAAGAATTAGAGAAATACATGTATGAAATTAAAAAACTACCAGATAAAATAAAAATTAAGATTGCAAATGGAGAAATATTAGAGGCTGACAAGAAAGGAAAGATAACCATAAGAGATAAAAATAATAATACTATAAATATAGAAGCGTTAATGGTCCCAGGGATTTATCATAATATAATATCTGTAAGAAACTTAAATATGAAAGGAAATAAAGTTGTTTTTACAAAATTTGGAGCACAAATAATAAATGGAAGAAAAGTCTTAAAATGTTCAGATAGAAATGGTTTATATATAGTACAAGGCGAAATAATACTAATAGAAGAAGCGAACTCAAGTGTACAGCAAGACAAAAATATTTGGCACCAACGTCTCGGACACTTAAATAGGAAATCATTAAAAATTATGGGTTTACCTGTGTCTGATGAAACATGTGGTCCTTGCATGAAGGGAAAATCTACTCGTTTATCATTCTATCCAGTTGACAGGCCAAGAAGTAGAAAAATAGGAGAATTATTGCATACAGATATTGGAGGTCCTGTATCACCAATTTCTTATGATGAAAAACAATATTACCAGACCATAACTGATGATTTTTCTCATTTTGTGACTGTTTATCTATTAAAGAATAAATCTGAAGCCACAAGAAATTTAATAAATCATATAAAGGAGTTAGAAAGACAAAAGGAAACTAAAGTTAAACGCATAAGATGTGATAATGGTGGAGAGTTCACCGCTGGCTGTTTGAAGCAATTTTGTATGGAAAATGGAATTATAATAGAGTATAGTCAACCTTACACACCACAACAAAATGGTGTGGCAGAGAGGCTAAACAGAACATTACTAGATAAGTCAAGAACTTTATTAAGTGAAACTGGATTACCTAAATATTTGTGGTCTGAGGCTATAATGTGTGCAGCATATCAATTGAATCGATGCCCATCAAGATCTATAAAGTATAAGATACCAGCTGAAATATACTACGGACTAGAAAATGTTAACTTGAACAAGTTAAAGGTATTTGGTTCTAAAGCATGGTATACGTGTGTCCCACAGAATAAGAAATTAGATAATAGAGCTGAAGAAGCCATTATGGTTGGCTATGGCAAACAAGGTTATAGATTATGGAATCCAAAAACAACAGAAATAATATTCTGCAGAGATGTCAAGTTTGATGAAAAGTACTATGAACATAAAAACAGTATTAAAAATAACAACTATATTTATTTACCAGAAGAGGACACACAAAATGAACTTATGTGCAATGATAAAAATAAAATTGAGGAAGAAAAAGTAATACAGAAAAATGAAGAGACAGACACAAAAAGAACTAGATCAGGAAGGATAATAAAGCAACCTGATTATCTAAAGAATTTTGGGACGTACACAGCATATTGTTACTTAGTGTGTAATGACCCAGAAAGCTATGAAGAAGCGATAAAAGAAGTTTCATGGAAAGAAGCGATACATAAGGAATTAGCAGCACTTGAGAACTTACAAAGCTGGGAAGAGACTAAACTACCGAAAGGAAAATTAGCTATAGACACTAAGTGGGTTTTTAGAACGAAAGACGATGGCACTAAGAAAGCCAGATTAGTCGCTCGAGGTTTTCAAATAAAAAAATTATGA
Protein
MLASLDKVFERKGIFTKLHLRRKLLSLKLRDDKLEDYFMRFESLIREIENIDKKMDEEVKICYLLTGMSEKYNTVITAIETMSADKIDMEFVKARLLDEELKLNNKGEEYNDTKNDVSFTASSVECYRCHKKGHFARECRSRGRGYSRRNINNKGICGKNRTGEQNNMTESIPENKYNFLAITECNLSREDKFIEFIIDSGATENLIKEELEKYMYEIKKLPDKIKIKIANGEILEADKKGKITIRDKNNNTINIEALMVPGIYHNIISVRNLNMKGNKVVFTKFGAQIINGRKVLKCSDRNGLYIVQGEIILIEEANSSVQQDKNIWHQRLGHLNRKSLKIMGLPVSDETCGPCMKGKSTRLSFYPVDRPRSRKIGELLHTDIGGPVSPISYDEKQYYQTITDDFSHFVTVYLLKNKSEATRNLINHIKELERQKETKVKRIRCDNGGEFTAGCLKQFCMENGIIIEYSQPYTPQQNGVAERLNRTLLDKSRTLLSETGLPKYLWSEAIMCAAYQLNRCPSRSIKYKIPAEIYYGLENVNLNKLKVFGSKAWYTCVPQNKKLDNRAEEAIMVGYGKQGYRLWNPKTTEIIFCRDVKFDEKYYEHKNSIKNNNYIYLPEEDTQNELMCNDKNKIEEEKVIQKNEETDTKRTRSGRIIKQPDYLKNFGTYTAYCYLVCNDPESYEEAIKEVSWKEAIHKELAALENLQSWEETKLPKGKLAIDTKWVFRTKDDGTKKARLVARGFQIKKL

Summary

Similarity
Belongs to the glutamine synthetase family.
EMBL
AB014676    BAA74713.1    GDHC01015802    JAQ02827.1    GBHO01027564    JAG16040.1    + More
GBHO01002761    JAG40843.1    GBHO01004832    JAG38772.1    GDHC01019310    JAP99318.1    GEDC01012841    GEDC01000503    JAS24457.1    JAS36795.1    GBHO01035173    JAG08431.1    GBHO01034936    JAG08668.1    GBHO01002616    JAG40988.1    GDHC01007058    JAQ11571.1    JXUM01244080    KQ636179    KXJ62430.1    GGMR01018348    MBY30967.1    GEZM01072005    JAV65635.1    JXUM01155348    KQ572178    KXJ68066.1    LBMM01010924    KMQ87150.1    GEZM01028916    JAV86195.1    GEZM01042286    JAV79968.1    JAV86196.1    ABLF02003343    ABLF02041793    JXUM01085595    KQ563513    KXJ73717.1    GEHC01000928    JAV46717.1    LJIG01022881    KRT78250.1    JXUM01025857    KQ560736    KXJ81076.1    GFTR01008662    JAW07764.1    KQ483843    KYP40338.1    JXUM01136904    KQ568499    KXJ68982.1    GBBI01004033    JAC14679.1    CM003606    KYP68607.1    KYP40337.1    OIVN01000332    SPC78433.1    OIVN01003986    SPD14739.1    OIVN01001906    SPC98838.1    OIVN01000486    SPC81000.1    GEHC01000895    JAV46750.1    GECZ01019212    JAS50557.1    LBMM01012492    KMQ86193.1    KF740825    AIC77183.1    OIVN01006217    SPD28032.1    OIVN01006466    SPD33659.1    OIVN01000260    SPC77257.1    KQ995285    KZV47435.1    JXUM01011189    KQ560325    KXJ83029.1    OIVN01002424    OIVN01005946    SPD03496.1    SPD24589.1    OIVN01006353    SPD31284.1    OIVN01006155    SPD26398.1    GECZ01025604    JAS44165.1    OIVN01001931    SPC99063.1    OIVN01000279    SPC77544.1    GDHC01007678    JAQ10951.1    OIVN01002029    SPC99965.1    OIVN01003431    SPD11153.1    ASHM01014005    PNX95963.1    NWSH01000816    PCG74073.1    OIVN01002361    SPD02992.1    KQ980795    KYN13016.1    OIVN01006472    SPD33779.1    LBMM01012772    KMQ86003.1    CM003608    KYP66219.1    KL367628    KFD61291.1    JYDJ01000808    KRX33413.1    JXUM01097527    KQ564351    KXJ72390.1    AM489192    CAN71109.1    MLFT02000010    PHT36714.1    KQ483853    KYP40164.1    KL367553    KFD64618.1    JYDJ01000136    KRX42725.1    GEZM01032204    JAV84770.1    AM433482    CAN69340.1    KQ460297    KPJ16236.1    KQ979396    KYN21742.1    GBHO01026200    JAG17404.1    KYP69041.1    KQ483623    KYP44533.1    AM447500    CAN74198.1    MJFZ01000929    RAW24142.1    ASHM01015075    PNX96991.1    AY009101    AAK12626.1    KYP66220.1    DF974005    GAU43961.1    DF973299    GAU24969.1    GEDC01029908    JAS07390.1    OIVN01001308    SPC92446.1    OIVN01006211    SPD27863.1    OIVN01002513    SPD04258.1    FJ544856    ACL97386.1    OIVN01004651    SPD18552.1    NWSH01002292    PCG68657.1    PCG68658.1    OIVN01004824    SPD19458.1    PSQE01000003    RHN67289.1   
Pfam
PF00665   rve        + More
PF07727   RVT_2
PF13976   gag_pre-integrs
PF13961   DUF4219
PF00098   zf-CCHC
PF17921   Integrase_H2C2
PF04827   Plant_tran
PF00069   Pkinase
PF00120   Gln-synt_C
Interpro
IPR036397   RNaseH_sf        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR001584   Integrase_cat-core       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR025724   GAG-pre-integrase_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR025314   DUF4219       
IPR041588   Integrase_H2C2       
IPR006912   Harbinger_derived_prot       
IPR000719   Prot_kinase_dom       
IPR008266   Tyr_kinase_AS       
IPR011009   Kinase-like_dom_sf       
IPR014746   Gln_synth/guanido_kin_cat_dom       
IPR008146   Gln_synth_cat_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
SSF56112   SSF56112       
SSF55931   SSF55931       
Gene 3D
PDB
5UOQ     E-value=1.40092e-07,     Score=136

Ontologies

Topology

Length:
749
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00724999999999999
Exp number, first 60 AAs:
2e-05
Total prob of N-in:
0.00037
outside
1  -  749
 
 

Population Genetic Test Statistics

Pi
3.321286
Theta
4.764898
Tajima's D
-0.829215
CLR
0
CSRT
0.168891555422229
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号