SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00503
Pre Gene Modal
BGIBMGA012315
Annotation
PREDICTED:_uncharacterized_protein_LOC101740840_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.772 PlasmaMembrane   Reliability : 1.398
 

Sequence

CDS
ATGGCTTCGAAGTTTACCAAGAACGCAATACTAACAAGGACATTGCATTCGTGCTGTCTCGTCTGCGAAACTTACCTTCCAAGCGAACGAGATGTCGCACTGCATATTTCAAAGGAAGAACACAAAAAAAGTCTAGAAGCTAGTAGTTTCGTGGCTGAGTTTATCGAGGACCGCATAAGGAAGGTCAAGAAGGGATTTTTCTGTGAGTTCTGCAATAAATATCTATCAACAATAATCAAAGGAAGGTTCCATGTAACAGGCAATGAGCATATCCGTAATAAGGGCGCCTATCTCTTCGAGCGTTTGGAGAATGGCATGGTTCTCTTTAGAAACATTGTTATCACGAAAGAAGCATGGAATGGGATCATTGGAAAGAAATGCATTATTTGCGCTATTGAATTCAATGATGTGAAGAAGCACATTACCAGCGTTAAACACATTTTCAATATGTTAAAGTTCGATGTGCAATTCGGGATTTACGGTGGACTGTACAGGAAGACGATGGACGATTCGTTCCATTGCTTAACTTGCAACGAGGTTTTTGAAAGCCCAACTCGAGCGTGTATTTCGTCGCATTTTTTACATCCTAACCACCAAGAGATTTACGATAAATTAGAAAAGAGTTCCAAAGAACAAATCGAACAGTCTAATTATCAACAGAAACTGTCCAATTTAACTGATCCAAAGGGAACTGCAGAATCCAAAGATCCGATCCTGAAGAAAGTGCCCATGGAGAGATACATCAACGATTTTTATCCTATCAAGAATCCATGTTTGGGCGGCACAGATATTGTCATCAACATGAGAACAGTTGTGAACATTTTCAGTTTCTATTTTATAACACAGCTGAACTCATTGATATGTGAAGTATGCGAGGTCACATTGACGCTTGATGAAATTGACACACACAAAGTCACCAAGAAACACGAGCGTGCAATGATGGACACTCCAGTTATTGTACTAAGATGTGCTGAAGACGAGTTTATCAGAGAGGTACGTCCTGAAATATACCATTGCGGCTATTGCAACATCACATACAATGGCTTGAGCAAAATCGTCTATCACTTGAACACGTCTAACCACAAGGAATGCAAAACTTCTTCCTCTTGGCGTTTCTACATGCATATCCAGACTAAGAATAAAAATAAACAACAGAAAACTTCAACGCCATCTTCAAAGATGACGTCGAAATTTAACAAGAACGCGATCCTATTGGGGTCTGCGTACTCCTCCTGCCTCGTTTGCGATACTTACATCTCAAGCGAAGTAGATGCTGCGAAACATATCTTAAAGGAGGAGCATAAAGCAAATCTAGACGCAAGCCGTTTTGTGGATGAGTTTGTCGATGACTACATCAGGAAGGTGAAGAAAGGATTCTACTGTGAGCTCTGCAATCAATGTATTGCAACGATGGACATAGGAAGGGTTCATGTATCGGAAAATGAGCATATCCGTAGGAAGGATACTTCTTGCTTCGAATGCTTGGGAAACGACTTGATTATTTACAAAGACGTGGCCATCACAAAAGAAGCATGGAATGGGATTGTTGAGAACAAGTGCATACTCTGCGACATTCAATGCGATGATATGGAGGATCACATTTCTAACGCAGATCATCTTGCTAAGATGCTGCAAGTCGAGGTGGAGTTTAGGATCTATAATGGACTCTACAGAATGATGGACAACTCATTCCAATGCTTGACATGCAACGAGGTTTTTAGGTTGGTGAAAACCTCAATTCAAGCATGTGTAACAACACATTTTTTACGCTCCAAACATAAGCAGATACAAGAAAAACTGGCAAAGGCTGCAAAAGATGCCACTGATATTGTACAACTTAAAGAGTTTGGTCAATATTTCAATAAAAATAAGTCGGAGCTTTCAAAGGATCTGATTATTAAGAAGGAGACTATGGAGCAATTCATCAATAATTTTTATTCTATCGAAGTGCCATTTTTGGGAGGCACTGACATTGTTATCAATACGAAAATTGTCGTCAACGTTTTCAGCTTTTATTTCATAACAAAGGATACTCTGAAATGTATGGCTTGCAATGTCAAATTGACGATTGATCAAATCGACAGCCATAACGTAACTTTGAAACACGAAACTGCGATGAAGGAAACTCCAGTTATTACGTTAAAGTCTGCCGAAGACGAGTTTATCAGAGAGGTACGCCCTGATGTTTACCACTGCGGTTTCTGCAATAGCATCGAACACGGCTTGGATAATATGTTGGAGCACTTTGGTACCTTCGGCCACAGGGAAAGCAGGACTTCTGCCTCGTGGCGTCTTCACATGTTATTAAGAAGCAAAGGAAAGTCCAAAGAAGCTGTGCAAGATCGTTCTACAGAACGTTTTGGTGAAAAATGGAAGAGAACAGGACCCATAGTCAGTAGGCTTATTGGAGTATATAGTCTCACATATACATATAGTCTTCAGTACATGCAGGTTATGTGTTGGGTGCGTTTCGTAAATATACGATTCGGTTTGGACGGATGCTGA
Protein
MASKFTKNAILTRTLHSCCLVCETYLPSERDVALHISKEEHKKSLEASSFVAEFIEDRIRKVKKGFFCEFCNKYLSTIIKGRFHVTGNEHIRNKGAYLFERLENGMVLFRNIVITKEAWNGIIGKKCIICAIEFNDVKKHITSVKHIFNMLKFDVQFGIYGGLYRKTMDDSFHCLTCNEVFESPTRACISSHFLHPNHQEIYDKLEKSSKEQIEQSNYQQKLSNLTDPKGTAESKDPILKKVPMERYINDFYPIKNPCLGGTDIVINMRTVVNIFSFYFITQLNSLICEVCEVTLTLDEIDTHKVTKKHERAMMDTPVIVLRCAEDEFIREVRPEIYHCGYCNITYNGLSKIVYHLNTSNHKECKTSSSWRFYMHIQTKNKNKQQKTSTPSSKMTSKFNKNAILLGSAYSSCLVCDTYISSEVDAAKHILKEEHKANLDASRFVDEFVDDYIRKVKKGFYCELCNQCIATMDIGRVHVSENEHIRRKDTSCFECLGNDLIIYKDVAITKEAWNGIVENKCILCDIQCDDMEDHISNADHLAKMLQVEVEFRIYNGLYRMMDNSFQCLTCNEVFRLVKTSIQACVTTHFLRSKHKQIQEKLAKAAKDATDIVQLKEFGQYFNKNKSELSKDLIIKKETMEQFINNFYSIEVPFLGGTDIVINTKIVVNVFSFYFITKDTLKCMACNVKLTIDQIDSHNVTLKHETAMKETPVITLKSAEDEFIREVRPDVYHCGFCNSIEHGLDNMLEHFGTFGHRESRTSASWRLHMLLRSKGKSKEAVQDRSTERFGEKWKRTGPIVSRLIGVYSLTYTYSLQYMQVMCWVRFVNIRFGLDGC

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
834
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
8.345
Exp number, first 60 AAs:
0.00271
Total prob of N-in:
0.00422
outside
1  -  834
 
 

Population Genetic Test Statistics

Pi
1.54346
Theta
3.608917
Tajima's D
-2.302846
CLR
2.020025
CSRT
0.00144992750362482
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号