SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00502
Pre Gene Modal
BGIBMGA012314
Annotation
PREDICTED:_uncharacterized_protein_LOC101740840_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.668
 

Sequence

CDS
ATGACTTCGAATTTTAGCCAGAACGCAATTTTATTTGGGACTTTGCAGTCGTACTGCCTTGTCTGCGAATGCTACCTCGCAGGCAAACGAGACACTATACGGCACATTTCAAAGGATGACCATAAAACAAATCTGGAAGCTAGCATTTTCGTGGAGGAATTTACAACTGATCAAATAAGAAAGGTTAAAAAGGGATTCTTCTGTGAGCTGTGCAATAAATACTTTTCAACCATAATACAAGGACGGCTCCACGTATCGGATGGTGAACACGTCCGTAATAAGGGCGTCCAACTATTCCAGCGGATGGAAAATGGTATGGTCAGCTACAAAAACATACCTATCACGAAAGAAGCATGGAATGGGATCATTGAAAACAAGTGCATAATCTGCGACACAGAATTTGATTCTCTGGAGAGTCACATAACTAGCCAAGAACATCTTTTTCAGTTGGTACAGGTAGATGTGGAGTTTGGTGCTTACAACGGACTCTACAGAGTGTTGGAAAACGCGTTTCAATGCTTAACATGCAACGAAGTTTATACACCAGTAAATACGAATGTTGAAGCAAGTGCAACAACGCATTTCTTAGAGTCTAAACATAAAAGGATTTATGACAAATTAGCGAAAGCTGCAAACGAACAGTTACAAGTTAACGACAAACGTACGAATAAAGGAAAATCACGTGGTTTAAATGCGAAGAATGCTTTAAGCCGCCAGCTGTCATCTGATTCGTCCCTTGCAAATGAAGATGACAACGACGACGGAATCAAGATGCTGTCCATCGAGAAATTCATCAATGATTTTTATGCGATCAAGGGCACATCTCTGGGCGGCAAAGATGTTGTCATAAACACAAAAATAATTGTGGGGCTCTCAAGCTTTTATTGCATAACGAAATTGGATACTTGGAAATGTGAGATCTGTGACCTCACTTTAAACTCTGATGATATTGACGCCCATAGACTCTCTCAGAAACATGAAGCTGCAATGAGTGACACTCCAGTCATATTAATACAGGCTGCGGGAAATGAATTTATCAGAGAGGTACGTCCCGAAGTTTACCACTGTGGCTTTTGCAACATCGTCGAACAAGGCATGGACACCATCTTAAAGCACTTGAATACCGCAGATCACAAGCAAAGCAGGATATCTGCAGCTTGGCGTCTCCACGAGCACATGCTGGTTAAGAAATTGGAATAA
Protein
MTSNFSQNAILFGTLQSYCLVCECYLAGKRDTIRHISKDDHKTNLEASIFVEEFTTDQIRKVKKGFFCELCNKYFSTIIQGRLHVSDGEHVRNKGVQLFQRMENGMVSYKNIPITKEAWNGIIENKCIICDTEFDSLESHITSQEHLFQLVQVDVEFGAYNGLYRVLENAFQCLTCNEVYTPVNTNVEASATTHFLESKHKRIYDKLAKAANEQLQVNDKRTNKGKSRGLNAKNALSRQLSSDSSLANEDDNDDGIKMLSIEKFINDFYAIKGTSLGGKDVVINTKIIVGLSSFYCITKLDTWKCEICDLTLNSDDIDAHRLSQKHEAAMSDTPVILIQAAGNEFIREVRPEVYHCGFCNIVEQGMDTILKHLNTADHKQSRISAAWRLHEHMLVKKLE

Summary

Pfam
PF06220   zf-U1        + More
PF12756   zf-C2H2_2
Interpro
IPR013087   Znf_C2H2_type        + More
IPR036236   Znf_C2H2_sf       
IPR013085   U1-CZ_Znf_C2H2       
IPR041661   ZN622/Rei1/Reh1_Znf-C2H2       
IPR003604   Matrin/U1-like-C_Znf_C2H2       
SUPFAM
SSF57667   SSF57667       
PDB
6AHD     E-value=0.0615577,     Score=85

Ontologies

Topology

Length:
399
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.37696
Exp number, first 60 AAs:
0.36142
Total prob of N-in:
0.01968
outside
1  -  399
 
 

Population Genetic Test Statistics

Pi
1.359463
Theta
3.837863
Tajima's D
-2.541116
CLR
25.673861
CSRT
4.99975001249937e-05
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号