SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00477
Annotation
PREDICTED:_uncharacterized_protein_LOC107445205_[Parasteatoda_tepidariorum]
Location in the cell
Nuclear   Reliability : 3.824
 

Sequence

CDS
ATGGTATATAAATACAAGAGGAAGACTAATCAAGCCCAATGGAGTGAGGACAGTATGATGCTTGCAATAGCAGACTGCAATTCTGGCATTCCTGTCAAAACGACCGCAAAAAAGTATGGTCTACCTTACGCCACTCTCTATAGGCATTGGAAAAAAGGTAGTTCGACGGCTCAGCTTGGTCGTTTTCGTAAAGTTTTCAACGATGGTCAAGAGGGAGATCTTCGAACGTATTTGTATGAAATGGATAGTGTTTTTTATGGGCTAACCCGAGAAGATTTTAAAACATTAGTTTTTGAATACGCGAAACGCAATAATGTCACTTATCCGCCTAGTTGGGACAAAAATAAAAAAGCTGGTGATGATTGGCTAGCAGGATTTATTAGAAGAAATCCACAAATTACACTAAGAATTCCAGAAGCAACCACAATTGGCAGAGTTAAAGGCTTCAATCGTCCTCAAGTAGAAAGGTTCTATAAACTGTTAAGTGAACAAATTGAGAAGTGTCAAATTGATGGTACTAGAATCTATAATATAGATGAAACTGGCATTCAGACCTCGACAAATAAACCACCCAAGGTTCTTTCAGTTAAAGCTTTACAGTACGCAACTGAAAATAATGTCATCATTTTGTCTTTGCCACCGCACACCTCAAACAAACTTCAACCTCTGGACGTGGCTGTATATGGTCCATTTAAAATATTCTTCGAGCAAGAAATCAATAGATTTCAAAAGGCTCATCCAGGTAGGATAATCAACCAATACGATGTAGCCAAACTGTTCAGTCCAGCTTATCTGAAATCTGCTACTCCTAACAATGCTATCAAAGGCTTTCAATCAACCGGTATCTGGCCAACAAATAAAGATATATGGGGAGAAGAAGATTATGCACCATCTTCTATTACAATGACAGACCGTAATACCGCTAACCAACAGGAGACTTTTATAGACTCAAACAGTCAAAATGTTGAAATTACGATTGACATCGAAAAGCCTTCTACATCAGGGCTCCAAAGTCAGTCACTGCAAATTGATGTAGAACCACTGGAACAGATTGGAAGAAAATTTATTGACAATGTGAATGTAGAAGTTGAAGCTGCAGTGGAAAATAGTATCATGGGTATAGTATCAGTGTCCAATATGAATCAAATACATTCTCGAGATACATCGCCTTCAATTTTGGATAAATTACCCGACAAAGATCCCCTTACATGCAATGCTGTTGTAGTAACGGCTGTAGCTGATAATACTCAAAAATTGTCTAAACCACAAGAAGCAATGTCCACTGAAGATATGAATCAAGGTGCAGATCTGACTCAAGACAGTATAGATATAAAAGAGGGTCAATTTAAAGGCAACGATGATGAAATTATTATGGACCTGGAATCATCTACGGCTCGGGCTTCAGCATATTTCAGTCCTAAAGACATAAGACCGCTTCCGATGCCACGCGTTTCTGTGGGTACACGTAAAAGAAAGGTTCAAAAGTCTGAGGTGTTAACAAGCACGCCGGTGAAGCGAGAACAAAAAGAAAAATTTATAAAAATTAATGTCAAAGCAATGAAAAATATGAATATAGATTTAAATGCTAAACCAAAGACTGCGACAAAGAAAAATACTAAAACGACCAAAAATATAATTGTTAAAGATAAAAGCAGTGATAAGGAAAACGAGGAAGAACAGTGTGTATGCTATTATTGCGGGGAGAACTATATAGAAATAAATAAAAAACCAGTTGAGGATTGGATTCAGTGTGATAAATGTAAGCAATGGAGTCACGAAAAATGCACGGCTTATGGAGGAATAGGCTTATTCTTTTGTGATATCTGCACGGATTAG
Protein
MVYKYKRKTNQAQWSEDSMMLAIADCNSGIPVKTTAKKYGLPYATLYRHWKKGSSTAQLGRFRKVFNDGQEGDLRTYLYEMDSVFYGLTREDFKTLVFEYAKRNNVTYPPSWDKNKKAGDDWLAGFIRRNPQITLRIPEATTIGRVKGFNRPQVERFYKLLSEQIEKCQIDGTRIYNIDETGIQTSTNKPPKVLSVKALQYATENNVIILSLPPHTSNKLQPLDVAVYGPFKIFFEQEINRFQKAHPGRIINQYDVAKLFSPAYLKSATPNNAIKGFQSTGIWPTNKDIWGEEDYAPSSITMTDRNTANQQETFIDSNSQNVEITIDIEKPSTSGLQSQSLQIDVEPLEQIGRKFIDNVNVEVEAAVENSIMGIVSVSNMNQIHSRDTSPSILDKLPDKDPLTCNAVVVTAVADNTQKLSKPQEAMSTEDMNQGADLTQDSIDIKEGQFKGNDDEIIMDLESSTARASAYFSPKDIRPLPMPRVSVGTRKRKVQKSEVLTSTPVKREQKEKFIKINVKAMKNMNIDLNAKPKTATKKNTKTTKNIIVKDKSSDKENEEEQCVCYYCGENYIEINKKPVEDWIQCDKCKQWSHEKCTAYGGIGLFFCDICTD

Summary

Pfam
PF03184   DDE_1
Interpro
IPR011011   Znf_FYVE_PHD        + More
IPR013083   Znf_RING/FYVE/PHD       
IPR004875   DDE_SF_endonuclease_dom       
SUPFAM
SSF57903   SSF57903       
Gene 3D
ProteinModelPortal

Ontologies

Topology

Length:
611
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.004
Exp number, first 60 AAs:
0.00241
Total prob of N-in:
0.01130
outside
1  -  611
 
 

Population Genetic Test Statistics

Pi
6.306486
Theta
4.553046
Tajima's D
-0.567261
CLR
0.27194
CSRT
0.225488725563722
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号