SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00456
Pre Gene Modal
BGIBMGA003354
Annotation
PREDICTED:_uncharacterized_protein_LOC106720810_[Papilio_machaon]
Full name
ATP-dependent DNA helicase      
Location in the cell
Nuclear   Reliability : 3.215
 

Sequence

CDS
ATGTCGTCGACCGAGTCGGAGTCTGTTTCAAATGCAGAGTACGAAAGTTTATCCCAGAAAATCATCGTGGAAGTACAGAAAAGACCAGCTTTATACGATACTACTTTGCGTCAATACAGTGATAGAAATGTGAAAAATAAACTTTGGGAGGAAGTTTATCACAACGTAGTTAATAATTGGATGACACTGTCGGAGGCTGAGAAAAAAAAGAAGGGTAGTACAATACAAAAGAAATGGAAGAATATGCGCGACAGTTTTTCTAAAGAATTATACAGCGTGGTAGTTAAGGTAGCTGTTAGATGTAGACTCAGGCCCGTCAGACCCTGGATGCTGAACGCCACGCATCTCAGAGCTGCTGAGACAGTGGAACAGACTCAGACACGTCGAGTTTTAGATGCCGAACGTCACGCGCAATTGATTGCGGCAGAGACTGACGAAGATTCACAAAGACGACGTCTTTTAAATGCTGAACGGCAGGCAGAAAGAAGACGTACGTTTTCAATGAGTACGTGGGAGGCATTTAATGGTGCCGCTTTTGAGTATGACCCTTTGATCGACTATGTTAATCACCGATTGGTTATCATTGGGAGAATGGATAAAAAATGCAGATATTGTGGAGCACTGAAATGGAAAGAAGAAACTCCAGGTATGTGCTGTTCTGGTGGAAAGGTTAAAATTCCATTACTTGGCGAGCCAGAGGAACCTCTTAAATCTTTACTTTTATACGACAGTAACGAATCGCGCCGGTTTTTAAGCAGGATTAGAAAGTATAATTCTTGCTTTCAGATGACGTCATTTGGTGTAGATAAGGAGGTCGTAATGCCTGGATTTTCACCTACTTTTACCATCCAAGGACAGGTGTATCACAGGATTGGTTCCTTACTTCCCGCAAATAATGAACAACCAAAGCTTTTGCAACTTTATTTCATGGGCGATGAAAAAAACGAAGCTGATCGCAGGTGTCAAAATATACAAGGAATCGAAAGGGATACTGTTTTAAAAATCCAGAGAATGTTGCATGAACATAATCGCCTTATCAATACTTTCAAAACAGCACTAGAAAGAATGCCGGGAGAGGATTATAGGTTGGTGATGCACCCCGATCGCACACCAAGTGGGGAACATGAAAGGCGGTATAATGCACCGTTAATAAATGAAGTCGCAGCCTTGGTTACAGGCGAACAGTTTGCTTTCCGTGATATAGTTTTACAGGCCCGAGATGACACATTAACCAGGGTGCCTGATACTCATAAATTTTATGATGCGTTGCAATATCCGATCATATTTAGTAAGGGACAAGAGGGGTACCACTTTCAAGTTCCTCAAATTAATCCTGTAACAGGTCTTCCCTTGCATAACAAAAAGGTTTCATGCATGGATTTTTATGCCTACAACATGATGATACGAGAAAACAACTTTAACATTGTACAAAGATGCAAGCAACTGGCCAATCAGTCTTACGTTGACATGTACGTTAAAGTTGAAAGCGAGAGGTTACGGTACATATCATTAAATCAAACTAAACTAAGAGCAGAGAATTACATCCATCTTCAAGACGCTGTGGCAAATGACGCTAATTTAAATCCAAATAACTTAGGTCGTATGGTCATTTTACCATCTTCATTTGTAAATAGCCCGCGGTACTTACACGAATATACTCAGGACGCGTTTGTTTATGTGCGTACACATGGTCGCCCTGACTTATTCGTCACCTTTACTTGCAACCCAGCCTGGCCCGAAATAGTCAATCAGTTGATGCCGGGGCAAAGCGCAATAGATAGACATGATGTAGTCGCAAGAGTTTTGAGACTAAAAGTTAAAAAACTAATGGATGTGATTAATAAAGGCCGAGTGTTCAGAGAAGCGCGCTGCTTTATGTACTCTGTCGAATGGCAGAAACGTGGACTGCCACATGTCCATATATTATTGTGGTTAAAAGATAAGTTACGACCCGATCAAATAGATAACATAATCAGCGCTGAAATACCGGATCCTAACATTGACAAGACTCTCCATGACATTATTGTAAAAAATATGATTCACGGTCCATGCGGACCCGAAAATCCACAGTGCCACTGCATGAAAGACGGAAAATGCACAAAAAAATTTCCTCGCAAGTTAGTGAAAGAGACCGTTCACAACGACCACGGATACCCGCAGTATCGTAGAAGAGCGCCAGCAGACGGAGGTCGAACAGCAACCGTGAAGCTCCGAAATGGTAGCTACGTTACAGTTGATAATAGTTGGGTAGTCCCCTATTCACCAATTTTATCAAAAATGTTTAACGCCCACATAAATGTTGAGGCATGCAGTTCAGTACGCGCCATCAAATATATTTGCAAATATATAAACAAGGGTAGTGATCAAGCTATTTTCAATTTTAGAAATACTGATCTTGCGAATCCCGTAGATGAGGTACAAACTTATCAGTCTGGTCGGTATGTCAGCAGCAACGAAGCCGTGTGGCGTCTGTTAGCATTTCCGTTGCACGAAAGGCATCCCACCGTGACACATCTCAGCGTGCATTTAGAAAATGGTGAACGCGTTTATTTTAATGAACACAATTTCCACGAACGAATAACTACTCCGCCAAAAACCACACTCACTGCTTTTTTTGATCTTTGTATCAGAGATGAGTTTGCAAAAACTCTTCTTTATGTCGAGGTGCCGAGGTATTATACTTGGGATGCAAGTAGGAAAACTTGGAAACGCCGCATTCAAGGTACTTCAGTTCACGATTGGCCTGGCGTCAAATCTGGAGATGCTTTAGGACGAGTTTATACAGTTCATGTTAGTAACATGGAATGTTTTTGTCTACGCATGCTTTTACACCATGTGCGCGGACCTACCTCTTTCAATGATCTAAAAAAATACAACACACAAGATTATCCTACATTTCGAGAGGCATGTGAGGCAAGAGGATTACTGGAGAATGACAACCATTGGGATGTGACACTGGAAGAAGCTGCTCAATGTAGATCAGCAGGCAAGATGAGAGAGCTATTTGCTGTATTAGTAGCGACATGTGGTCTTTCAAATTCTCAACAATTGTGGGATAAATACAAAAATGATATGACCGACGATATATTGCACAGATTACAAGAGCAAAATCCCAATGTCACGTACAGTGATTTAATTTACAATGAGGGTCTGACAAAAATTGAAAACCAGGTTAAAACAATTTCTAGAAAGGATTTATCAGATTATGGAATGATCAGACCACAGAGAACCGAGGAAATCAGTAGCGATTTAATACGGGAACTAGATTACGATACTGCTTCCTTACAACAACAATTGACAGAGTCTGTTCCACGTTTGATCCCAGAACAAAGGTTAGTATTTGACAATGTTTTCAAAAAAATCGAAGATGGCGAAGGTGGTTTGTTATTTTTGGATGCTCCCGGAGGCACGGGAAAAACCTTTCTTTTAAACTTGCTTTTAGCGCAAATCCGAAAAGATAAAGGAATTGCTGTAGCAGTTGCCTCTTCCGGAATAGCCGCCACTCTGCTCAATGGTGGTCGAACGGCACATTCGGTGCTTAAACTGTCATTAAACTTAGCCCATGAAGAAATGCCAGTCTGTAATATAAGTAAAAACAGCGAGCGTGGACGTATGTTGCAGCAATGTAAATTATTAGTTTGGGATGAGTGTACTATGTCCCATAAAAGAGCAATTGAAGCTCTAGATCGGACTTTGAAAGACATCAAGAGTAATCCAAATATCATGGGGGGGGATGGTGGTACTTTTAGCGGGCGATTTTAG
Protein
MSSTESESVSNAEYESLSQKIIVEVQKRPALYDTTLRQYSDRNVKNKLWEEVYHNVVNNWMTLSEAEKKKKGSTIQKKWKNMRDSFSKELYSVVVKVAVRCRLRPVRPWMLNATHLRAAETVEQTQTRRVLDAERHAQLIAAETDEDSQRRRLLNAERQAERRRTFSMSTWEAFNGAAFEYDPLIDYVNHRLVIIGRMDKKCRYCGALKWKEETPGMCCSGGKVKIPLLGEPEEPLKSLLLYDSNESRRFLSRIRKYNSCFQMTSFGVDKEVVMPGFSPTFTIQGQVYHRIGSLLPANNEQPKLLQLYFMGDEKNEADRRCQNIQGIERDTVLKIQRMLHEHNRLINTFKTALERMPGEDYRLVMHPDRTPSGEHERRYNAPLINEVAALVTGEQFAFRDIVLQARDDTLTRVPDTHKFYDALQYPIIFSKGQEGYHFQVPQINPVTGLPLHNKKVSCMDFYAYNMMIRENNFNIVQRCKQLANQSYVDMYVKVESERLRYISLNQTKLRAENYIHLQDAVANDANLNPNNLGRMVILPSSFVNSPRYLHEYTQDAFVYVRTHGRPDLFVTFTCNPAWPEIVNQLMPGQSAIDRHDVVARVLRLKVKKLMDVINKGRVFREARCFMYSVEWQKRGLPHVHILLWLKDKLRPDQIDNIISAEIPDPNIDKTLHDIIVKNMIHGPCGPENPQCHCMKDGKCTKKFPRKLVKETVHNDHGYPQYRRRAPADGGRTATVKLRNGSYVTVDNSWVVPYSPILSKMFNAHINVEACSSVRAIKYICKYINKGSDQAIFNFRNTDLANPVDEVQTYQSGRYVSSNEAVWRLLAFPLHERHPTVTHLSVHLENGERVYFNEHNFHERITTPPKTTLTAFFDLCIRDEFAKTLLYVEVPRYYTWDASRKTWKRRIQGTSVHDWPGVKSGDALGRVYTVHVSNMECFCLRMLLHHVRGPTSFNDLKKYNTQDYPTFREACEARGLLENDNHWDVTLEEAAQCRSAGKMRELFAVLVATCGLSNSQQLWDKYKNDMTDDILHRLQEQNPNVTYSDLIYNEGLTKIENQVKTISRKDLSDYGMIRPQRTEEISSDLIRELDYDTASLQQQLTESVPRLIPEQRLVFDNVFKKIEDGEGGLLFLDAPGGTGKTFLLNLLLAQIRKDKGIAVAVASSGIAATLLNGGRTAHSVLKLSLNLAHEEMPVCNISKNSERGRMLQQCKLLVWDECTMSHKRAIEALDRTLKDIKSNPNIMGGDGGTFSGRF

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Cofactor
Mg(2+)
Similarity
Belongs to the helicase family.
Feature
chain  ATP-dependent DNA helicase
EC Number
3.6.4.12
EMBL
NIVC01000229    PAA87485.1    NIVC01000366    PAA84583.1    NIVC01001445    PAA67902.1    + More
NIVC01000111    PAA90396.1    KE126587    EPB66060.1    JARK01000714    EYC35207.1    NIVC01001359    PAA68995.1    KN743176    KIH52626.1    NIVC01001486    PAA67379.1    HQ009558    AEE09607.1    NIVC01000900    PAA75136.1    KN739487    KIH54222.1    GL444143    EFN61253.1    ABLF02041819    ABLF02018127    JOJR01000041    RCN48933.1    ABLF02020814    ABLF02049665    NIVC01001383    PAA68602.1    ABLF02017703    ABLF02041883    NIVC01002034    PAA61410.1    NIVC01000566    PAA80831.1    NIVC01001945    PAA62370.1    NIVC01000381    PAA84309.1    NIVC01001722    PAA64736.1    NIVC01004666    PAA46875.1    ODYU01007113    SOQ49602.1    NIVC01000042    PAA92669.1    NIVC01002018    NIVC01001743    NIVC01000051    PAA61561.1    PAA64516.1    PAA92464.1    BEXD01001738    GBB95559.1    BDIQ01000091    GBC29771.1    BDIQ01000010    GBC12419.1    JEMT01027503    EXX56857.1    LUEZ02000010    RDB29535.1    AWUE01015533    OMO96975.1    BDIQ01000117    GBC37632.1    AACS02000012    EAU86521.2    BDIQ01000188    GBC51003.1    OIVN01000105    SPC74366.1    AWWV01014072    OMO58887.1    KZ866277    RIA04643.1    AP003196    BAD81603.1    AP008207    BAF04484.1    KN818726    KIL54493.1    BDGU01000723    GAW08762.1    NIVC01002407    PAA58126.1    NIVC01002028    PAA61494.1    DP000086    AAP52492.2    AC105746    AAM92800.1    AP008216    BAF26194.2    AAP52578.2    AC104322    AAN09850.1    DF849855    GAT59324.1    LUEZ02000013    RDB28029.1    OIVN01004665    SPD18618.1    OIVN01005182    SPD21271.1    CM007650    ONM59070.1    CM007647    ONL95700.1    ONL96266.1    NCVQ01000010    PWZ07722.1    NCVQ01000003    PWZ39636.1    ONM57938.1    NCVQ01000001    PWZ54641.1    NCVQ01000008    PWZ14360.1    CM000780    AQK60210.1    CM000785    AQL04010.1    PWZ05017.1   
Pfam
PF05970   PIF1        + More
PF14214   Helitron_like_N
PF02689   Herpes_Helicase
PF12854   PPR_1
PF13041   PPR_2
PF13812   PPR_3
PF00258   Flavodoxin_1
PF02902   Peptidase_C48
PF03399   SAC3_GANP
PF09425   CCT_2
Interpro
IPR027417   P-loop_NTPase        + More
IPR010285   DNA_helicase_pif1-like       
IPR025476   Helitron_helicase-like       
IPR038765   Papain-like_cys_pep_sf       
IPR003653   Peptidase_C48_C       
IPR003840   DNA_helicase       
IPR003323   OTU_dom       
IPR011990   TPR-like_helical_dom_sf       
IPR002885   Pentatricopeptide_repeat       
IPR013955   Rep_factor-A_C       
IPR012340   NA-bd_OB-fold       
IPR008254   Flavodoxin/NO_synth       
IPR005062   SAC3/GANP/THP3       
IPR018467   CCT_CS       
IPR029039   Flavoprotein-like_sf       
SUPFAM
SSF52540   SSF52540        + More
SSF54001   SSF54001       
SSF50249   SSF50249       
SSF52218   SSF52218       
Gene 3D

Ontologies

Topology

Length:
1253
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.5547
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  1253
 
 

Population Genetic Test Statistics

Pi
15.553067
Theta
21.766281
Tajima's D
-1.553393
CLR
0
CSRT
0.0533473326333683
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号