SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00454
Annotation
PREDICTED:_uncharacterized_protein_LOC101738169_isoform_X1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.616 PlasmaMembrane   Reliability : 2.09
 

Sequence

CDS
ATGACGCGATCTTCATTGTCTTATAAATGTGATTGTATTTACAGATTTAACCTTATTGCAATTGAGGATTTGCCCGCTGGGGAACCGATAGAGCAGGCATTGACGGAGCGAAGTAAGCGTTCATGGAACCCCCGAAATTATGAACCTGACGGAGAGGACATTCCAGTAATTTTGTCTTCACCTGCGATTCCGCCATCACCGGCAATGTACGTTGAATGTGGCGGCAGTGGTACGAGCACGCCATCTTCTAGATATAATTACAGATTTCTGTACATGGCAGCCGTAGTCCTTTGCCGTCACATAAACGTGTGCGTCGATCGCTTTGCCCAGACCAAGAACATGATACTACGAACAGAGATTCTATTTCATCGCTACGTCGACCGCTACGAGACTGAAATTTGCTACTTGTTGCACTATGGAAGTGACGACGATGACAGCGATGATGAGAGCCAGAATGATAACGACGAAATCGTTCCTATGATCATCCCCCGGGCAGCTGGAATACTGATGGACACTCCGGACGACGAGGAGATTGAGATTGACACGGCGGCGGCAAGTAAACCTCTTGTGACATCTTCCTCGCCTTCTATCATTTCAGCACCTACATCACCAGCGCGTGATACCGGTATGAAGCCTAGTCATTTTTTTGAATTTGACTGGGGAACTTTCCCTGACTCTCCTATACCACCAACAGAAAGGCGTGAATCTTTTAAGGAAAACTCTGGTCCCACGGTCACTGAGTACATGGAATTTATTGTGCAGGAAACAAATAGATATGCCCAACAATTAGCTGCTGAAATGTTGGACGGCGGGGAATTACAGGCCTCCAGTAGGATTACAGAATGGAAAGAAACCAATGTAGACGAGTTATTGGTGTTCTTCGGAATATTACTGGCGATGGGAATCGTCATAAAGAACCGGGTTGAAGAGTACTGGAATACGGAACAAAACATCTTCTCCACTCCAGGTTTCAAAGTATATATGTCGCTTAGGAGGTTCCAGTTACTCAGCAGTTGCTTACATTTTAATAATTCCAAGAACTTGAGAAACCTCAACCTGGATCCCTCACAGGCAAAGCTTTTTAAAGTAGAGCCTGTGATTAGCCATTTGAATTCCAAGTTCACGGAGTTATATATAATGAAGCAGAACATGGCTTTAGATGAATCGCTGCTGCAGTGGAAATGTTGGTTGAACATCAACCAATTTATTCCAAACAAAGCTGCAGCAGTGGGCATAAAAACTTACGAAATATTTCTTAACCTTATCAAAGGTTTAGAACACAAAGGGTACACGTTGTGGATGGATAACTTCTACAATTCCCCAGCACTTGCCCGAAAACTCAAGTCGATTGGGTTTGATTGTGTCGGTACGTTGCGGACAAACCGCAAGTATGTCCCGACGGAACTGACCAATCTGAAAAAATCTCAGATGAAGCCCGGGCAAGTAGTAGGCTATACCAGTGGAGATGTCGATTGCATAATATGGAGAGATCAGAACCGCGTAGCGACGATCTCAACGTACCATGGCAATGCCGTCTCCACTAAAAACGGAGTAACAAAACTTATTTTGATACGTGACTACAACATCTGCATGGGTGGCGTGGATAAAAAAGATCAGATGTTGGCTGCATTCCCAATTGAACGCAAGAGGACACAAATTTGGTACGAGAAATTGTTTAAAAGGTTACTTAATGTTTCTGTGTTGAATGCCTATATCATACATAAACAGACTGCCACGGAGGTCTTGGACCACAGGGGCTTTAGAAAAAACCTGGTAGAATCCCTTTTGCGTAGGCATTCAATGAAAATGTAG
Protein
MTRSSLSYKCDCIYRFNLIAIEDLPAGEPIEQALTERSKRSWNPRNYEPDGEDIPVILSSPAIPPSPAMYVECGGSGTSTPSSRYNYRFLYMAAVVLCRHINVCVDRFAQTKNMILRTEILFHRYVDRYETEICYLLHYGSDDDDSDDESQNDNDEIVPMIIPRAAGILMDTPDDEEIEIDTAAASKPLVTSSSPSIISAPTSPARDTGMKPSHFFEFDWGTFPDSPIPPTERRESFKENSGPTVTEYMEFIVQETNRYAQQLAAEMLDGGELQASSRITEWKETNVDELLVFFGILLAMGIVIKNRVEEYWNTEQNIFSTPGFKVYMSLRRFQLLSSCLHFNNSKNLRNLNLDPSQAKLFKVEPVISHLNSKFTELYIMKQNMALDESLLQWKCWLNINQFIPNKAAAVGIKTYEIFLNLIKGLEHKGYTLWMDNFYNSPALARKLKSIGFDCVGTLRTNRKYVPTELTNLKKSQMKPGQVVGYTSGDVDCIIWRDQNRVATISTYHGNAVSTKNGVTKLILIRDYNICMGGVDKKDQMLAAFPIERKRTQIWYEKLFKRLLNVSVLNAYIIHKQTATEVLDHRGFRKNLVESLLRRHSMKM

Summary

Pfam
PF13843   DDE_Tnp_1_7
Interpro
IPR029526   PGBD       

Ontologies

GO

Topology

Length:
603
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.544769999999999
Exp number, first 60 AAs:
0.00321
Total prob of N-in:
0.02595
outside
1  -  603
 
 

Population Genetic Test Statistics

Pi
3.791157
Theta
4.668888
Tajima's D
-0.78498
CLR
0.133032
CSRT
0.182840857957102
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号