SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00452
Pre Gene Modal
BGIBMGA013747
Annotation
PREDICTED:_uncharacterized_protein_LOC105843021_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.87
 

Sequence

CDS
ATGTTTGCTTTACCACTCACAGTATTTAACAATGGTGGAATTTATGGAAGCAAATGGAGATTTATCAAAACCATCAGGCGGTCCACGAGGTCGCAATTTTATACAGATGAAGTGGAAGGAGATCCTAAGAGTGAGGACAAATGGCGTAAGGTGTGGAGCGATTATAAGAATAATTGCAAGAAAAAGTGTGCTAAAATTAATAGAGCTGCTAGTGGCACTGGTGGCGGACCAGCGCTCCATTTATTATTGACTGACCAGGAACAAAGGGTCATGCAGATAATTGGAGTGCAGGCAGCTACTGGCATGGAGATAAAAGAAGCTGGGTTTCCACAAGAAGAAATTTCAACTGAGAGGCCAAATACTCAAATTATTTTAAAGGAACCGGAAATAGATTGGAACACTCCTAGCACAAGCAGTCAACCAACAGTGGCTCCACCAACACCAACTGAGGCTCCCCCTCCAGTTATTAACGAGGAAGAGGAGTGGAACCCTCCGCCACAGAAAAAAAGAAAAAACAATTTAACAAAAATGTTTTTAGATATAGAAAAGCAAGAAAGAAAGAAAGAAGAAAGAAGAAAGAAAAGAAGAAAGAACAGAAAGGCAAGGGAGTATGCTTCAGAGCGTGATAGGGTATATGAGGAATTAGAAAGAGATCGGTTGAGAGTTAGAGAATTTGAGGTACGTGAAAGAGTAAGACAGAGAGATGAAGAGCTACGGATGCAGGGTCAATGGCTGGAATTTATGAAAGAGGCAATGGAAGCTTTTGTGAGGTTTATGGAGAGAAAGTCTTAA
Protein
MFALPLTVFNNGGIYGSKWRFIKTIRRSTRSQFYTDEVEGDPKSEDKWRKVWSDYKNNCKKKCAKINRAASGTGGGPALHLLLTDQEQRVMQIIGVQAATGMEIKEAGFPQEEISTERPNTQIILKEPEIDWNTPSTSSQPTVAPPTPTEAPPPVINEEEEWNPPPQKKRKNNLTKMFLDIEKQERKKEERRKKRRKNRKAREYASERDRVYEELERDRLRVREFEVRERVRQRDEELRMQGQWLEFMKEAMEAFVRFMERKS

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
263
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02049
Exp number, first 60 AAs:
0.01601
Total prob of N-in:
0.00857
outside
1  -  263
 
 

Population Genetic Test Statistics

Pi
1.035237
Theta
2.748548
Tajima's D
-1.568387
CLR
0
CSRT
0.0453977301134943
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号