SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00448
Pre Gene Modal
BGIBMGA002333
Annotation
Copia_protein_[Trachymyrmex_cornetzi]
Location in the cell
Nuclear   Reliability : 3.999
 

Sequence

CDS
ATGGATTCTACAGTTTATGCAGCCAATGGTGAAAAAATGAAAGCACAAGGATCAGGTAAATCAGTACTAGAAACACTAACAAAAGTTGCAGACGGCATAATTATACAAGGACCAAAAGTATTACAAGAACAGTGTAAAATATGTGCTGAAGCAAAACAGTCAAGACTACCATTTAATACAATCAGAACTCGTGCTGAAAGGTACCTACAAATAATACACACAGACATATGTGGTCCCTTCGAAGAAAAGACTCATGATGGATATAGATATGTATTAACAATAATGGACGACTACAGTCATTTTACAAAAATCTATTTACTTAAAAACAAGAGCGATGCAAAAGAAGAAATTAAAAATTATATTGAAGAAACGGAGCGAGAGAAAAATAGTAAAGTATCGACTATAAGATGCGACAACGGAGGTGAATATACAAGTAACGATTTTAAAGCATTTTGTCAACAAAAAGGTATAAAATTAGACTACACAGTGCCCTACTCACCACAATTAAATGGAAAAGTTGAACGCCTAAACCGGACATTATTAGAAAAAACAAGAGCATTACTCTTTGATTCTAAATTGAACAAAGAAATGTGGGGTGAAGCAATATATTGTGCTACTTATATTTTAAACAGACTACCAAGTGATGCCCTGAAAAACAAAACACCATATGAAATGTGGGTTGGAAAAAAGCCTAATATATCTAATATGCAAAAGTTTGGTTCTACTGTCTATGCAAAACAGTTACATCCAAATGTAAAGAAACTGGATCCTAGAAGCAAGAAACTAATAATGATTGGATACACTAATAATGGGTACAGACTGTGGAATGACAAGGAGAGAAAAATAGAGATATCAAGGGACATAGTGATAGTAAAAAGTGAAACTGAACAAAAGAAAGAAAACTATAAGAAAATAAATAATAATAAAAGTGAAAATGATGAAAAAGAGACAGACCAGGAAGAGACAACAGAAAACCAGGAAGAGACTATATACAACCAGGAAGAGACAACAGAAAACCAGGAAAAGACTACAGAAAACCAGGAACAGATTATAGAAAACCAGGAAGAGACAACAGAAGATACCAGAACAGAAGAAAATAAAAATGATGAGATTTTTGAAGATGTAGTATCAGAAACTGAATCAGAAGATACAGAAAGAGAAAGAAACAGACATCATGAAGAAAACGAGAGGCTGTAA
Protein
MDSTVYAANGEKMKAQGSGKSVLETLTKVADGIIIQGPKVLQEQCKICAEAKQSRLPFNTIRTRAERYLQIIHTDICGPFEEKTHDGYRYVLTIMDDYSHFTKIYLLKNKSDAKEEIKNYIEETEREKNSKVSTIRCDNGGEYTSNDFKAFCQQKGIKLDYTVPYSPQLNGKVERLNRTLLEKTRALLFDSKLNKEMWGEAIYCATYILNRLPSDALKNKTPYEMWVGKKPNISNMQKFGSTVYAKQLHPNVKKLDPRSKKLIMIGYTNNGYRLWNDKERKIEISRDIVIVKSETEQKKENYKKINNNKSENDEKETDQEETTENQEETIYNQEETTENQEKTTENQEQIIENQEETTEDTRTEENKNDEIFEDVVSETESEDTERERNRHHEENERL

Summary

Pfam
PF07727   RVT_2        + More
PF00665   rve
PF13976   gag_pre-integrs
Interpro
IPR001584   Integrase_cat-core        + More
IPR012337   RNaseH-like_sf       
IPR013103   RVT_2       
IPR025724   GAG-pre-integrase_dom       
IPR036397   RNaseH_sf       
IPR039537   Retrotran_Ty1/copia-like       
IPR001878   Znf_CCHC       
SUPFAM
SSF53098   SSF53098       
Gene 3D
PDB
3DLR     E-value=3.16685e-09,     Score=148

Ontologies

Topology

Length:
398
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00123
Exp number, first 60 AAs:
0.00055
Total prob of N-in:
0.01431
outside
1  -  398
 
 

Population Genetic Test Statistics

Pi
6.691686
Theta
19.823657
Tajima's D
-2.006698
CLR
0.003603
CSRT
0.0128493575321234
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号