SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00445
Pre Gene Modal
BGIBMGA008616
Annotation
putative_DNA_helicase_[Cotesia_vestalis_bracovirus]
Full name
ATP-dependent DNA helicase      
Location in the cell
Nuclear   Reliability : 2.147
 

Sequence

CDS
ATGGGCAACATGGAAGAACAACTTGATCGACGCCTAGAGATCAATGCAGGAATGAAGCGAGCAATTCTTCAAGACTTGCAGTGTCTGCTTCATGAACATCATGCGTTGGTCAGGTTGTTTAAGAGTGCTTTAGAGCGCATGCCAAGTGATGACTATAAAGTTGTTATCAAAGCAGATAAACGACCATCTGGAACACACGAAAGGACATTTAATGCTCTAACAGTAGACGAAGTTGCCATCCTGATTGTTGGTGAACAATTGGAAAAACGCGATATTGTGCTTACACGTCGCGATACTGGGCAACTGCAACAAATATCTGAAACTCATCGATCATATGACACATTGCAATACCCGCTGATGTTTTGGCAAGGAGAAGATGGATATTATTTTAATATTAAAATGAAAAATCCATTGAATGGTGAAGAAACTACAAAGAAAGTTAGCTCAATGAATTATTACGCATATCGTTTGATGATTCGTCAAAATGCTGACAACTATTTGCTGCGGTTTCGTCGATTGTTTCAGCAGTATTGCGTTGACATGTATGTAAAAATAGAAACGGAACGTTTAACATTCATTAGGTTGAACCAAGCCAAACTGCGTTCTGAGGAGTACATCCATTTACGTGATGCAGTTAGTACTGAAGGAAATGCAGCTAATATTGGTCGATTAACTATTCTGCCGGCGACATACATTGGTAGTCCACGTCATATGCATGAATATGCACAAGATGCAATGACATATGTTCGTCATTACGGTCGGCCTGATCTCTTTATTACTTTTACCTGTAATCCAAAATGGATAGAAATTACTCAATTGCTGCTTCCCGGACAAACATCAAGTGATAGACACGACATCACAGCACGTATATTCAGGCAAAAAATTCGGTCCCTGATGAACTTTATTGTTAAACAACGCGTCTTTGGAGATACTCGATGCTGGATGTATTCAATCGAATGGCAAAAGCGAGGCCTGCCGCACGCACACATTCTTATTTGGTTAGTGGAAAGAATTCAGCCTGACCAAATAGATGATATCATATGTGCTGAGATTCCTGATTATGAAGTCGATCCAGACCTACATGATGTTGTTACTACTAATATGATTCATGGACCGTGTGGTGCCATCAATCCCCAATCACCTTGCATGGTCGATGGAAAGTGCTCTAAACGATACCCACGGAAATTAACGGCGGAGACTGTCACTGGCAATGATGGTTATCCGCTGTTAGGAATGCCAGCACCATATCGTGAAATGAATGACGCATTTAATCGAGAATTGGAAAGGGAACGTGAATATGATCACCAGGAATTAGATTTAGTAGTTCAAACGAATGTACCCCTGTTGAATTACCAACAAAAGGAAGTTTATGATACTTTAATGAAGGCAATCGATGATGAAAATGGTGGTTTATATTTTCTAGATGCCCCTGGTGGAACTGGCAAGACATTCCTCATGTCATTAGTTTTAGCAACTGTTCGGGCGAGATTTAACATAGCGGTTGCAGTTGCTTCTTCTGGAATAGCAGCCACATTGTTAGAAGGATGCCGTACGGCTCATTCAGCATTCAAATTACCGTTAAATCTTCAAACTATTGAAGAACCAACGTGTAATATTGCAAAACACTCAGCAATGGCCAAAGTTTTAGCGAGGACCTAA
Protein
MGNMEEQLDRRLEINAGMKRAILQDLQCLLHEHHALVRLFKSALERMPSDDYKVVIKADKRPSGTHERTFNALTVDEVAILIVGEQLEKRDIVLTRRDTGQLQQISETHRSYDTLQYPLMFWQGEDGYYFNIKMKNPLNGEETTKKVSSMNYYAYRLMIRQNADNYLLRFRRLFQQYCVDMYVKIETERLTFIRLNQAKLRSEEYIHLRDAVSTEGNAANIGRLTILPATYIGSPRHMHEYAQDAMTYVRHYGRPDLFITFTCNPKWIEITQLLLPGQTSSDRHDITARIFRQKIRSLMNFIVKQRVFGDTRCWMYSIEWQKRGLPHAHILIWLVERIQPDQIDDIICAEIPDYEVDPDLHDVVTTNMIHGPCGAINPQSPCMVDGKCSKRYPRKLTAETVTGNDGYPLLGMPAPYREMNDAFNRELEREREYDHQELDLVVQTNVPLLNYQQKEVYDTLMKAIDDENGGLYFLDAPGGTGKTFLMSLVLATVRARFNIAVAVASSGIAATLLEGCRTAHSAFKLPLNLQTIEEPTCNIAKHSAMAKVLART

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Cofactor
Mg(2+)
Similarity
Belongs to the helicase family.
EC Number
3.6.4.12
EMBL
HQ009558    AEE09607.1    ABLF02021131    ABLF02042289    GL444143    EFN61253.1    + More
HACG01044765    CEK91630.1    HACG01044764    CEK91629.1    KN727000    KIH66715.1    KE126587    EPB66060.1    KN739487    KIH54222.1    JARK01000714    EYC35207.1    JOJR01000041    RCN48933.1    KN743176    KIH52626.1    KE125664    EPB67478.1    JARK01001590    EYB87952.1    JOJR01000205    RCN42227.1    KN740537    KIH53717.1    JARK01001339    EYC32590.1    APCN01007923    KE125416    EPB68565.1    KN768033    KIH47189.1    KN767628    KIH47497.1    NIVC01002773    PAA55312.1    NIVC01000900    PAA75136.1    NIVC01001359    PAA68995.1    NIVC01001486    PAA67379.1    NIVC01000111    PAA90396.1    NIVC01000366    PAA84583.1    NIVC01000229    PAA87485.1    ABLF02006716    ABLF02036458    NIVC01001445    PAA67902.1    KN740416    KIH53763.1    ODYU01007016    SOQ49380.1    GECZ01005881    JAS63888.1    ODYU01013296    SOQ60003.1    ABLF02018127    ABLF02006224    ABLF02066369    KE125418    EPB68548.1    JARK01001572    EYB89086.1    ABLF02020814    ABLF02049665    ABLF02011507    ABLF02067513    NIVC01000001    PAA94775.1    NIVC01004365    PAA47686.1    NIVC01001383    PAA68602.1    NIVC01002034    PAA61410.1    NIVC01000291    PAA86185.1    NIVC01002407    PAA58126.1    NIVC01004811    PAA46541.1    NIVC01002028    PAA61494.1    NIVC01002018    NIVC01001743    NIVC01000051    PAA61561.1    PAA64516.1    PAA92464.1    NIVC01000042    PAA92669.1    NIVC01000566    PAA80831.1    NIVC01004209    PAA48195.1    NIVC01002707    PAA55791.1    NIVC01000853    PAA75959.1    NIVC01000136    PAA89829.1    NIVC01000506    PAA81945.1    NIVC01000353    PAA84930.1    NIVC01002606    PAA56554.1    PAA84578.1    NIVC01000296    PAA86068.1    NIVC01000587    PAA80345.1   
Pfam
PF05970   PIF1        + More
PF14214   Helitron_like_N
PF02689   Herpes_Helicase
Interpro
IPR027417   P-loop_NTPase        + More
IPR025476   Helitron_helicase-like       
IPR010285   DNA_helicase_pif1-like       
IPR003840   DNA_helicase       
IPR003323   OTU_dom       
IPR038765   Papain-like_cys_pep_sf       
SUPFAM
SSF52540   SSF52540        + More
SSF54001   SSF54001       

Ontologies

Topology

Length:
552
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.09772
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.00235
outside
1  -  552
 
 

Population Genetic Test Statistics

Pi
2.790083
Theta
2.430597
Tajima's D
-1.300247
CLR
0.005568
CSRT
0.0782960851957402
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号