SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00436
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Stegastes_partitus]
Location in the cell
Nuclear   Reliability : 4.427
 

Sequence

CDS
ATGGATAAATACAATCCAGATATATTCAGAATTGACGATTACATTGATTTTTTCGAAAACAAATGCAAAATTCTTGATATCGATAACAGCAACTTACAGAAAGATTTGCTTCTGAATTTACTAACACCAGAGATATTCCACGAATTAAAAGTAGCTTTAACGCCTGATTTCGATATAGCTACATACAGCGAAATTTGTAACAACTTATTAGACCTCTATCGCATAAAAACGACGAGGTATAGAGCCTTAACAGAATTCTGGAATTGCACTAGAGAACAAAATGAAACGATGGAACACTATGCAAACAGATTAAAAGGTCTTAGTCGGGATTGTGGCTACACTAATGACTTCCTGGAACGACAATTACGTGACCGCTTTGCCACTGGATTGAATCATCCAGATTTAGAAACCGACTTGAAACAAAAATGGCCTGATTTAGTTCAAATGGTAGACGGAATACCAAGAGAAGTAACCCTTCAACAAATTTTTACAATCTCTCAATCAAGAGAACAAGCAGAACAAGACACACCACGAACAAGTATTAAAAAAATAAATAGGAGCAAAACCAAAACCGTACCATTACATCAAAATACAACACGAAAATTAAATCCAATGCATTGTTTACGCTGTGGAAAGAAAGAACGGCAGAGCCTATCACAGTGTTCAGCCAAGGACCATATTTGTAAAGAATGTAACACGAAAGCACACTTTGAGAGTTGTTGCATTAAGTCTGGACGGGCATACATCAGCTATTCAGAAGGGAGCCGAAAATCAATTAAAAAAATAACAAGACCTCATAAGTCCTCAACATCATCATCATCATTTATCAGTAATAACGAGGAAGAAAGCGATGATGAAGTTATCTGCAGCGTCTTGGGTACACGTAAGAGAGAATGCAAACAAATCGATGTACGGATCAATGACATACCTTGCACTATGGATCGGGACCCCGGCTCTGCGTATTCAATAATAAACACGACATTGTGGAAAAAATTAGGATCACCATCTTTACAACCCGCCCCGAAACTTAAAGCCTACGGCAACACAAACTTAAAAACAAAGGGAATTACAAAAGTGACAGTCGAAGTCGACGGACTGCAAAAACTTCTACCTGTGGTCGTAATGAAAAATGCCAAACCAATGTTATTTGGTTTACATTGGAGTGAAGTTTTTGAAATGGAATTTCCAAAACCAGTATACTCCATCAAAACATCAACACCGATTACTCTTAAACAAATACTGGATAAACATTCACAACTCTTTGATGGAAAACTAGGAAAAGTTAACAATTATTACGTAAACATACATGTCAAACCAGAAGCTGAACCGATCCACTTTCCTGCACGGCCTATAAAATTTAGCATGAAAAAGAATATAGAAAGGGAGATAGATCGTCTGATCTCAGAAGGGATAGTGGAAAAAGTAGATCCTAATATTACACCTATTGAATGGGCTACACCCACAGTTAACATTCTGAAATCTACAGGGGAAGTTAGGATATGTGGAGACTACAGAACTACACTTAATCCAGTACTTATTAAACATCTACATTACAAAACATCATTATTAAACCCAGTTCCAATTTTCGATCAACTACGCCAAAATCTCGCAAACGATACAAAGAAATGCATAACGTCTTCACAACCATTAATTGCATTTGACGAGAAACGTCCCCTTTATTTAGCATGTGACGCTTCCGAAAAGGGATTGGGTGCAGTATTATTCCACAAGGACTCGAACATAGAACAACCAATTGCTTTTGCTTCAAGGAAACTACGACCAGCGGAAATGAAATATTCCGTTATTGATCGTGAAGCTTTAGCAATAGTATTTGGTATAAAAAAATTTGATCAGTACTTGAGAGGAACGAAATTTAATCTAGTTACGGACCATAAGCCTCTTATAAATATTATGGGTGCACGCCGCAACCTTCCTAAACTAGCCAATAACCGATTGGTAAGATGGGCTCTAGTAGTGGGAAATTATCAATATGACATTTGCTACAGGAAAGGTGAAAATAACACATTAGCTGATTGCTTTTCCAGATTACCAAACCCTGAAACGGAACCCTCCGAGACAGAAGGGCTTGTACATAAAATAGAACTACGTCTTTTGAGCACTCGAATGACTGACCTTAACCTATCAGAACAGTTACTTATGAAAACAACTGCAAAGGATCATATACTCACAAAAGTTTGTCAAAATTTAAAAACCGGCTGGAGAGAATCAGAATACAATCCAGAAATGAAACCATTCTACAGAAACCGGACTGAATTATCTGTTGAGAATAAGATACTTATGAGGCAAAGACGCATCGTTATACCTACAGCACTCCGAAAAGCCATTCTTACATACCTTCATCGAGGACATCCTGGCATTTCTGCTATGAAAGCACTTTCACGTTACTATGTTTGGTGGCCTAACCTTGACGAAGACATAGAATTATTTGTCAAGAAATGTACCAGATGCCAACAGAACCGCCCTTGTAATCCTGAACTTCCTGTATTTTCCTGGTCCATACCAGAAGAAGTATGGGAGAGAATCCATATCGACTTTGCTGGACCGTTCGAAGGATCGTATTGGTTGGTATTGTGCGACGCTCTCTCTAAATGGGTGGAAATACGACCGATGAAAAACATCAACACCAGATCACTTTGTCTTACATTAGATAACATATTTTGTACATTTGGCTTACCAAAAATTATTATATCCGATAATGGAACTCAATTTACATCTTATGAATTTAAAGAATATTGCACAAAACAGTCGATTTTACATGTCACATTATCTCCATATCATCCTCGGACAAATGGGCTGGCAGAACGTTTAGTCAGAACATTCAAAAATAGAATGGCATCGGTAGACAACACAAATCTCGAGCGCCGACTATTAGAATTTTTGTTTACATACAGAAACACTCCGCACTCGTCCACTGGTAAATCTTCAGCTGAGATGATGTTTGGAAGACAATTGAATTGCATACTTTCCAACATTACGCCAGACAAAGGAAGATTAATGCAGTATTTGCAAGTAAAAGAAAATATTCGTACCACATCACCGAGTTACCGACCAAGAGGACTAGAAAAACGAAGACATGCTGATCACATCAGGCCACGCGAGTTCTCCACCTCAGAAACCCCGAGGAATGAAAGGGCGCATTCTTCTATGCTGTCGGCGACTGCTTCTCCAGACATTGGAATGGAAACAACAATTAGCGAAAGGCTAACTAAAAACAAGAATTCGGCAGCAGTACCATTACCTACACCGCAGTCGCCTACAAATGTACAAATTTCTCCAAATTCACCTTCACCGCATTCGAAGTTATACTCCTCACCTGCTCCGGTCTCCACTCTTGTGCCATTTGCTCCGCGTCGAAGTAATCGACGTATACAGGACCCCGTCGTCTGA
Protein
MDKYNPDIFRIDDYIDFFENKCKILDIDNSNLQKDLLLNLLTPEIFHELKVALTPDFDIATYSEICNNLLDLYRIKTTRYRALTEFWNCTREQNETMEHYANRLKGLSRDCGYTNDFLERQLRDRFATGLNHPDLETDLKQKWPDLVQMVDGIPREVTLQQIFTISQSREQAEQDTPRTSIKKINRSKTKTVPLHQNTTRKLNPMHCLRCGKKERQSLSQCSAKDHICKECNTKAHFESCCIKSGRAYISYSEGSRKSIKKITRPHKSSTSSSSFISNNEEESDDEVICSVLGTRKRECKQIDVRINDIPCTMDRDPGSAYSIINTTLWKKLGSPSLQPAPKLKAYGNTNLKTKGITKVTVEVDGLQKLLPVVVMKNAKPMLFGLHWSEVFEMEFPKPVYSIKTSTPITLKQILDKHSQLFDGKLGKVNNYYVNIHVKPEAEPIHFPARPIKFSMKKNIEREIDRLISEGIVEKVDPNITPIEWATPTVNILKSTGEVRICGDYRTTLNPVLIKHLHYKTSLLNPVPIFDQLRQNLANDTKKCITSSQPLIAFDEKRPLYLACDASEKGLGAVLFHKDSNIEQPIAFASRKLRPAEMKYSVIDREALAIVFGIKKFDQYLRGTKFNLVTDHKPLINIMGARRNLPKLANNRLVRWALVVGNYQYDICYRKGENNTLADCFSRLPNPETEPSETEGLVHKIELRLLSTRMTDLNLSEQLLMKTTAKDHILTKVCQNLKTGWRESEYNPEMKPFYRNRTELSVENKILMRQRRIVIPTALRKAILTYLHRGHPGISAMKALSRYYVWWPNLDEDIELFVKKCTRCQQNRPCNPELPVFSWSIPEEVWERIHIDFAGPFEGSYWLVLCDALSKWVEIRPMKNINTRSLCLTLDNIFCTFGLPKIIISDNGTQFTSYEFKEYCTKQSILHVTLSPYHPRTNGLAERLVRTFKNRMASVDNTNLERRLLEFLFTYRNTPHSSTGKSSAEMMFGRQLNCILSNITPDKGRLMQYLQVKENIRTTSPSYRPRGLEKRRHADHIRPREFSTSETPRNERAHSSMLSATASPDIGMETTISERLTKNKNSAAVPLPTPQSPTNVQISPNSPSPHSKLYSSPAPVSTLVPFAPRRSNRRIQDPVV

Summary

Pfam
PF00665   rve        + More
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
Interpro
IPR036875   Znf_CCHC_sf        + More
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR041373   RT_RNaseH       
IPR001995   Peptidase_A2_cat       
SUPFAM
SSF57756   SSF57756        + More
SSF53098   SSF53098       
SSF50630   SSF50630       
Gene 3D
PDB
3S3O     E-value=4.88675e-15,     Score=202

Ontologies

Topology

Length:
1135
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00114
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.00001
outside
1  -  1135
 
 

Population Genetic Test Statistics

Pi
0.231434
Theta
2.065005
Tajima's D
-2.174603
CLR
0
CSRT
0.00194990250487476
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号