SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00431
Pre Gene Modal
BGIBMGA013783
Annotation
AF461149_1_transposase_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.506 Nuclear   Reliability : 2.204
 

Sequence

CDS
ATGGACCTGAGACTGAAGAGATGCCGCGCTTTGTTGAAGCAGTACGCGGGAAAAAAATATCGGGAAATACTTTTTTCGGATGAAAAAATTTTTACCGTAGAAGAGAGCTACAACAAACAAAATGATAAGGTGTACGCACACAGTAGTGAAGAAGCGAGCAACCGTATTCCGCGTGTCCAACGAGGTCATTTTCCATCCTCGCTCATGGTATGGTTGGGAGTTTCTTATTGGGGCTTAACAGAGGTACATTTTTGTGAGAAAAGTGTAAAAACGAATGCAGTTGTGTATCAAAATACAGTAGTGACGAACCTTGTGGAAGCTGTTTCCCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTCGGCGCCAGCTCATAGAGCGAAGAGCACACAAGACTGGCTGGTGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGCAACACTTGGAGGAAAAGGCGTGCTCAAAGCCTCATCCCAATTTGGAGTCACTCAAGACATCCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGACTGGCCGCGCAGATTGAAGGCCTGTATTCAAAATCACGGAGGTCATTTTGAATAA
Protein
MDLRLKRCRALLKQYAGKKYREILFSDEKIFTVEESYNKQNDKVYAHSSEEASNRIPRVQRGHFPSSLMVWLGVSYWGLTEVHFCEKSVKTNAVVYQNTVVTNLVEAVSHTMFNNRHWVFQQDSAPAHRAKSTQDWLVAREIDFIRHEDWPSSSPDLNPLDYKIWQHLEEKACSKPHPNLESLKTSLIKAAADIDMDLVRAAIDDWPRRLKACIQNHGGHFE

Summary

EMBL
AF461149    AAN06610.1    AB363028    BAG15927.1    AB363006    AB363010    + More
AB363014    BAG15923.1    BAG15924.1    AB473770    BAH20555.1    AB363018    BAG15926.1    KQ459680    KPJ20472.1    U47917    AAB47739.1    JF779677    AEO90418.1    LNIX01000030    OXA41211.1    JOJR01000583    RCN36166.1    UYSL01019905    VDL71189.1    JOJR01000015    RCN51257.1    JARK01001411    EYC06502.1    JARK01001601    EYB87313.1    JARK01000255    EYC39473.1    CAVP010059404    CDL95787.1    PDUG01000012    PIC13506.1    DS268747    EFP00909.1    PDUG01000005    PIC23776.1    UZAH01001595    VDO19836.1    JARK01001337    EYC34439.1    DS268565    EFO90304.1    DS268428    EFO94379.1    DS268539    EFO88027.1    DS268492    EFP11689.1    JARK01001658    EYB84158.1    DS268508    EFO83264.1    DS268525    EFO85497.1    DS268679    EFO98285.1    DS268606    EFO93488.1    JARK01000176    EYC41234.1    PIC29926.1    DS268421    EFO88618.1    DS268612    EFO94085.1    DS268673    EFO98001.1    JARK01001418    EYC05389.1    DS268466    EFP06959.1    PDUG01000001    PIC51673.1    JARK01001345    EYC27589.1    HE601413    CAS00486.1    PDUG01000006    PIC20538.1    UYSL01020440    VDL74616.1    PIC28734.1    JARK01000059    EYC44525.1    EFP11674.1    LFYR01002220    KMZ56176.1    DS268545    EFO88382.1    UYSL01019770    VDL69590.1    PDUG01000004    PIC32571.1    UZAH01029309    VDP05368.1    KX931010    APL98300.1    HE601187    CAR99265.1    PIC53815.1    HE601047    HE600964    CAS00660.1    CAS01013.1    JARK01000073    EYC44053.1    HE601437    CAR99651.1    UZAH01027257    VDO90094.1    HE601507    CAR99239.1    HE600908    CAR99632.1    UZAH01036445    VDP45493.1    KA646003    AFP60632.1    DS268623    EFO94692.1    PDUG01000003    PIC39650.1    PIC32570.1    PIC22722.1    PIC39649.1   
Pfam
PF13358   DDE_3        + More
PF00292   PAX
PF00250   Forkhead
PF10320   7TM_GPCR_Srsx
Interpro
IPR009057   Homeobox-like_sf        + More
IPR038717   Tc1-like_DDE_dom       
IPR036388   WH-like_DNA-bd_sf       
IPR001523   Paired_dom       
IPR036906   ATPase_V1_fsu_sf       
IPR036390   WH_DNA-bd_sf       
IPR001766   Fork_head_dom       
IPR030456   TF_fork_head_CS_2       
IPR000792   Tscrpt_reg_LuxR_C       
IPR017452   GPCR_Rhodpsn_7TM       
IPR000276   GPCR_Rhodpsn       
IPR019424   7TM_GPCR_Srsx       
SUPFAM
SSF46689   SSF46689        + More
SSF46785   SSF46785       
Gene 3D
PDB
5CR4     E-value=5.18018e-11,     Score=160

Ontologies

Topology

Subcellular location
Nucleus  
Length:
222
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.57937
Exp number, first 60 AAs:
0.0008
Total prob of N-in:
0.24146
outside
1  -  222
 
 

Population Genetic Test Statistics

Pi
2.60964
Theta
7.124096
Tajima's D
-1.604079
CLR
0
CSRT
0.0420478976051197
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号