SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00420
Annotation
PREDICTED:_uncharacterized_protein_LOC101747137_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.721
 

Sequence

CDS
ATGCCGATCACCAGGAGCAACAAGGGATCATCGAGGGAACAGCCACTCGAACCTGCGGTTCAAGAATCCAGTCCGGAGGCAACAGAAGCGACGTCGTACGAAACATACGAGAGCTCCGCGACCGGTACGACCCAGAACACAAAACTTGAAGAGGCAACGACGCGGACACGTGGTGAAAATAGACCCGCGTCGAAGAAATCGCTACGACGTAAGGAACTGGCAGCGAGAGCGGAGCTGGCGGAAAAAGAATTGATAGAAGCACAAGCAGCCACTATAGCCGCCAGACTCCGCCTGCAATTGATTCAGGCCGAAAGCGAAGACGACGATGATTCCATTATAGAAGAGCCAAAGGACCGGGAGGACCAGGTTAGGGCCTGGGTCCAGACGTCGGCGGGCAGTATGGACAAGGAGCCCGCAGGCGAGCACATTGAGAACCACCCCGTCAGCAAGGCCAACATGGAAGATTGCAGCAACAGGGACCTGGCTAAGGCGATAGTGGAAGCAGTGAGGAGCGCAACGACCAAGGAGCTGCCGCCACAACCCGACTACATGCACCAGTTGCCGACGTTCGAAGGCGACTGCAGGGAGTGGGTGGCCTTCAAGGCTGTCTACGAGGATACCGCTCCACTCTTCTCAAGCGCTCAAAACATGGCGCGGCTGAGAAGAGCGCTGAAAGGACAAGCCAGGGAAGGAGTCCGCAGCCAGCTGTACTCCGAGAGCACACCGGAGGAAGTAATGGAATCACTGCGGCGGTGCTATGGAAGGGCGGACGCTTTAGTCTTAGCGGAGCTAGACCGCATACGAAGACTTCCAACGATAAGCGACTCCGCCTACGACATTTGCTCACTGGCGAGCAATGTTAACAATACCGTCGCAGCGATCAGGGGGCTGCGGAAACCCCAATATTTGATGTCGCCCGAACTGCTGAAGAGCATCGTCGACAAGATGCCGACCATCCTGAGGTTCCGGTGGTACGATCACATTATCGAAAAGACCGAAGGAGACCCGGACCTCAACACGATGTGCGGCTTCCTGAACAAGATGGCGGACCGGTGCGGGCCACACGCCGTGGCTGAAGTAGCAACGAAAAGACAACCATCGAGGCGACAGGCGACGCACGCCACAACCGACTGCACCGAGCGCGCAACTTCGGACAGAGTAATAATAGACAAGCCGGCGTGCCCGCAATGCAAGGATGGACACCCGCTGTACGATTGTCCGAGGTACAAGGGCGCTACAGTGCAGGAACGATGGAGAATGGCAAAGGAGTCGCGCCTATGTTACAAGTGCCTCGATGGTGAGCACCGAAAGCAATCGTGTCAACGACCGCCATGCCACACGTGCAAGCGCTGGCATCACCACTCGCTACACAACGAGAAGCCGGAGACAGAGCCAGCAGAGAACAGGGAAATCGCGAACAACGTGCGACTTCCCATCAACTGCACACAGATCAGCAGGGCGTACTTGAAGATGGTGCCCGTTGAAGTGTACGGGCCATCGGGATCGACGACGGTGCTGGCCCTGCTGGACGAAGGCTCCACTGTAACTCTCCTGGACTCGAGCGTGGCGAAGCAGATCGGCCTGAAGGGACCCAAGGAGACGCTCCGCCTCGAGACCGTGGGCGGGAAGACCCTAACGAAGAAGGACTCGATGAAGCTTAACATCAGAGTTCGAGGGCTTCACCAGCGGCAGAAGAGAATGATCTTCGGAGCGCGCACAATGGATGACATGAGCCTTGCACCCCAGCGACTGAAAAGAGAGACCATCGAAGGCTACGCGCACCTGAGGAGCCTGGCGGACCAGTTATATTACGAAGAACAATCCCCCAAACTATTGATTGGGCAGGACAACTGGGGACTCATCGCCGCCAGAAGGACGCGCAGGGGCAGGAGGAACCAGCCGGTAGCCTCATTCACCCAATTGGGATGGGTGCTACATGGCCTCGACGGCAGCAACGCAAAAGAGGTCAACTTCCTCACCTGCGCCCATGTATCGATGCGCGAAGAGGCCTTGGACAGACAGGTGAAGGAGCACCTCACGATAGAGTCGCGCCCAAGCGTCCGAGCACGAATATGGAAGCGAAGGTGCTCGACATCTTCGAGAAGGAGGACGACAGAGGTTGGAGACGCGATGACGGCCACTTCGAAGCTCGGACCTACAATCCCTGTTCGAAGCGTTGTTGCGGTTCCGGCAAAGGCTCGTCGTGGTTGTCGCGGACATCAAGGAGAGACATCGATATCCAGAAGCCGCGTGGGCAATAGAAGGCGCTGCATTCTGGCGAGCCTCGCAGGCGGTGTGACCCCAGGAGACATAGAGCTGGGGTCGAAGGAAGAAAAGACCCTGGGCCTGCGGTGGTTCTACGAGTCGGACGAGGTGGGATTCCGGACACGTCCACGAGACCCAAAGGATATAGAAGCACGGACCCCGACCAAACGAGAAGTAACTAGCGCGGTAATGTCAACCTTCGACCCTATGGGGCTGGCATCACCCGTGCTAATAGAAGGGAAAGCGCTCACTCAGAGCATTTGGCGGAGCGAGATCGACTGGGACGACGTCATCCTGGAAAAGGACGAGGTGGCGTGGAAACGCTACATGGAGAACCTCCGCACGTTGCAAGGCCTCCGAATAGCAAGGTGCTTCTCGTGCTGCAACACTGAGGGGGAGCTGCACACGTTCACCGACGCCAGCGAGAAGGCCTACGCGTGTGCAGTCTATTGGCGTCAGAAGACAGATGAGAGCACCTACCGCGTCACGCTTCTAGCAGGGAAAGCCAGGGTGACCCCACTGAGACCAGTCTCTATCCCAAGGCTGGAGCTGCAAGCTGCGCTGCTGGGGACAAGGATGGCGCAGGCGATAGCGGACGAATTGGACATCGCAGTTGGTGTAAGGACGTACTGGACTGACTCCAGTACAGTCCTGACATGGATAAAGACCGACCCGCGCACGTTCAAACCTTTCGTTGCGCACCGACTCGCCGAGATAGAAGAGTCAACGAAGCCCCAAGAATGGCGATGGGTGCCTGGCTCGCAAAACCCAGCAGACGACGCAACTAGAGAGGCGCCGGCGGATTTCGACCACACGCATCGGTGGTTTAATGGACCCGAGTTCCTGACGTGGGATGAATCGCGCTGGCCCAAGCCGCGAACATTCAAGCAAGAACCGTCTGGAGAAGAGAAAGAGGCCTTCCTGGTCGCCACGGCGAGGACCGCTGACGCTAGACCCACGCCCGATCCGCACAGATTCTCGAGCTGGGTCAAGTTATTGAGAGCAACAGCCAGGGTCCTCCAATTTATCGAGCTGTGTCGACCCCGGAAGGAGAGCGCCTGCGTGTCCAGACAATTGGAGCAGCAAGATCCCACGTGGAGGACGACGCGAGCGAAGCAGCCCCGATCAACATGGAAGATAAGGACTCCAGAAGCACCTACAGAAGCGTGGCTGCCGCTCGATCCGCCCCACTTGAAGAAGGCGGAGAAGATCCTACTGAGAAGCAGCCAAGGAGAGAGCTTCGGTGAAAAAGATCCCGAACGTCACCCCAAGTTGCGACGGCTCAACGTCGTGATGGAAGATGGCCTGTTGCGCCTGCGCGGACGTATCGACGCAGCGCAATACATAGATGCAGGCTGCAAGCGACCGATCGTGCTGGACGGGAAGCACGTGATAGCGAGATTATTGATCAAACACTATCACGAGGCGTTCCAGCACGGTAACCACGCAACGGTGATGAACGAGGTGCGGCAGCGCTACTGGATCCTAGGTCTAAGATCGATCATTCGAGCGACGGCCGTCCGATGCCAGTGGTGCAAGGTCTATCGGAGTACACCACGACTACCGCCCACCGGAGACCTGCCGATAGAGCGGCTACGACATGGAGAGCCGCCGTTCACCTGTGCTGCCGTCGATTACTTCGGGCCGATGACGGTGACTGTAGGACGACGTCACGAGAAGAGGTGGGGCGTGCTGTTCACATGCCTCACCACGAGAGCAGTTCACAGGGAGCTAGCAGCGTCACTGACGGCAGACTCAATGCTGTTAGCGCTGCGCAGGATGGCCGCCCGGCGAGGAACGCCCAAAGTCATTTACAGCGACAATGGGACTAACTTCGTCGGCGCCAACAAGGAGCTCAAGCAGGCAATCGAGAATGCAAGGGAAGCAGACGTCGTGTCACGGGCCGCTCAGATGAACATAAAATGGAAGTTCATCCCGCCAGGAGCGCCGAACATGGGAGGCGCGTGGGAACGTTTGGTGCGGTCCGTGAAGACCGCGCTGGCGGTCACACTGAAGGAAAGACACCCGAGGGAAGAAGTTTTGCACACTCTTCTGTTGGAGGCGGAGCACGTCGTCAACTCGCGACCGCTCGTCGCCAGGGAAGAGAGTTGGGAGTCAGAAGCACTCACGCCGAACCACTTCCTCATAGGGAGGTCTTGCGGAGCTCCAAGCATCGGCGACTACACAGACGAAGACCTGACCGGCAAAAGGACATGGAGAGTGGCGCAGCGTATGGCAGACCACTTCTGGAGTAGGTGGGTCAAGGAATACCTGCCTACGCTGCTGCCCAGGAAGATCGACGGGAGAGCAGCTGGCGAGGACTTGCAGTGTGGGGATACCGTCCTCATAGTGGACTCCACACTGCCACGCAACACATGGCCGCGCGGACAAGTTGTTCACACCTACCCAGGCCCCGACAACCGTGTACGAACCGTCGACGTCGGCGGTCTACTTAAGAGACCTGCCTCCAAGATGATCCTGCTGGTGCCTGCAACGAGCGACGAGCCCACGCCCATAGAGTCGCCACGACAAGGAGTCGGTGCTACGCACGAGGGGGAGGATGTTGGCGACAGCGGCGTCGCCCCATAA
Protein
MPITRSNKGSSREQPLEPAVQESSPEATEATSYETYESSATGTTQNTKLEEATTRTRGENRPASKKSLRRKELAARAELAEKELIEAQAATIAARLRLQLIQAESEDDDDSIIEEPKDREDQVRAWVQTSAGSMDKEPAGEHIENHPVSKANMEDCSNRDLAKAIVEAVRSATTKELPPQPDYMHQLPTFEGDCREWVAFKAVYEDTAPLFSSAQNMARLRRALKGQAREGVRSQLYSESTPEEVMESLRRCYGRADALVLAELDRIRRLPTISDSAYDICSLASNVNNTVAAIRGLRKPQYLMSPELLKSIVDKMPTILRFRWYDHIIEKTEGDPDLNTMCGFLNKMADRCGPHAVAEVATKRQPSRRQATHATTDCTERATSDRVIIDKPACPQCKDGHPLYDCPRYKGATVQERWRMAKESRLCYKCLDGEHRKQSCQRPPCHTCKRWHHHSLHNEKPETEPAENREIANNVRLPINCTQISRAYLKMVPVEVYGPSGSTTVLALLDEGSTVTLLDSSVAKQIGLKGPKETLRLETVGGKTLTKKDSMKLNIRVRGLHQRQKRMIFGARTMDDMSLAPQRLKRETIEGYAHLRSLADQLYYEEQSPKLLIGQDNWGLIAARRTRRGRRNQPVASFTQLGWVLHGLDGSNAKEVNFLTCAHVSMREEALDRQVKEHLTIESRPSVRARIWKRRCSTSSRRRTTEVGDAMTATSKLGPTIPVRSVVAVPAKARRGCRGHQGETSISRSRVGNRRRCILASLAGGVTPGDIELGSKEEKTLGLRWFYESDEVGFRTRPRDPKDIEARTPTKREVTSAVMSTFDPMGLASPVLIEGKALTQSIWRSEIDWDDVILEKDEVAWKRYMENLRTLQGLRIARCFSCCNTEGELHTFTDASEKAYACAVYWRQKTDESTYRVTLLAGKARVTPLRPVSIPRLELQAALLGTRMAQAIADELDIAVGVRTYWTDSSTVLTWIKTDPRTFKPFVAHRLAEIEESTKPQEWRWVPGSQNPADDATREAPADFDHTHRWFNGPEFLTWDESRWPKPRTFKQEPSGEEKEAFLVATARTADARPTPDPHRFSSWVKLLRATARVLQFIELCRPRKESACVSRQLEQQDPTWRTTRAKQPRSTWKIRTPEAPTEAWLPLDPPHLKKAEKILLRSSQGESFGEKDPERHPKLRRLNVVMEDGLLRLRGRIDAAQYIDAGCKRPIVLDGKHVIARLLIKHYHEAFQHGNHATVMNEVRQRYWILGLRSIIRATAVRCQWCKVYRSTPRLPPTGDLPIERLRHGEPPFTCAAVDYFGPMTVTVGRRHEKRWGVLFTCLTTRAVHRELAASLTADSMLLALRRMAARRGTPKVIYSDNGTNFVGANKELKQAIENAREADVVSRAAQMNIKWKFIPPGAPNMGGAWERLVRSVKTALAVTLKERHPREEVLHTLLLEAEHVVNSRPLVAREESWESEALTPNHFLIGRSCGAPSIGDYTDEDLTGKRTWRVAQRMADHFWSRWVKEYLPTLLPRKIDGRAAGEDLQCGDTVLIVDSTLPRNTWPRGQVVHTYPGPDNRVRTVDVGGLLKRPASKMILLVPATSDEPTPIESPRQGVGATHEGEDVGDSGVAP

Summary

Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
Interpro
IPR041588   Integrase_H2C2        + More
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
SUPFAM
SSF53098   SSF53098       
Gene 3D
ProteinModelPortal

Ontologies

Topology

Length:
1617
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00055
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1617
 
 

Population Genetic Test Statistics

Pi
19.346554
Theta
33.187307
Tajima's D
-0.997202
CLR
0.000031
CSRT
0.141392930353482
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号