SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00397
Pre Gene Modal
BGIBMGA000725
Annotation
ATP-binding_cassette_sub-family_B_member_3_[Trichoplusia_ni]
Full name
Multidrug resistance protein homolog 49      
Alternative Name
P-glycoprotein 49
Location in the cell
PlasmaMembrane   Reliability : 4.501
 

Sequence

CDS
ATGGGGGTCAAAAAAGAAAAAAAAATAAAACTCGAAGAAAATATCGTTGAATCGTCACTTTCTTTCTTTCAAATATTTCGTTACGCCACGTGGTTGGAGCTTACGGCCACAATCTTGGGGACAGTATTCGGACTTCTCAGTGCTGGAGGTGTCACCTACAACCTGATGCAAGTTGGAGAAATGAGCACTGCCTTTGTTGAGAGAACTGTGCCGCCGGACAGATTGACCAGTAAAATGCCTATAATGTCTCTATTTGGAGGCGGTCGGAGATTATACAATGCCACGCACGAAGAAAATATGGCTGCTTTGATCGAAGATGCACAAGCTGTGGCTATAGGGGCATTTGTCAGTATAATCTTCTCGATATTATGCAACGTTCTATCGGTGGCTTTGGTAAGCTGGAGTGCACTCAAACAGATAACTACCATACGAAAGCTGTTTCTGACAGCAGTACTTCGTCAAGACATGACTTGGTTTGATACCGATTCTGATTTCAATTTAGCTTCGAAAATGTCTGAAAATCTAATGAAGCTTAAAGAAGGCATGGGTGAGAAATTGGCCGTGGTATCTAACTTAGTAGGCACCTCCATCATATGTTTATGCACTGCGTTTCCGCTGGGTTGGAAACTTGCGCTCGCTTGCATCACCGTTATGCCATTCTCAATAATGGCTTCTGTCGCTCTTACAAATTATCAAACCAAATCCTCTATTCGAGAAATGGAATCTTACAGTCAAGCTGGAAAGCAAGCCGAAGAAGTATTAAAATCTGTAAAGACGGTCGTGGCATTTGGTGGAGAAAATATTGAAGTTCAACGTTACAAATCATTGTTAGAGCCCGCTGAAATAAGTGGAAGCAGACGCGGCTTATTCACAGGACTGGGAAACGGTTTTAATTGGGTTCTCACGTATTCTCTAAACACAATTGGATTCATGTATGGCACTCGACTCATTATTGAAGATGCCAACAAACCAGACGACGAGAGAACTTACATTATTGGAATTGTATTAAGTATTACGTTTTCGGTGTACATGGCGACACAATCGATTACGCTCTGTGTGCCTCATATGGAAGTGTTCGCGACGGCCCGTGGTGCGGCCGCCAGTATTTTTAGCTTGTTGGACAAACACCCTAAAATTGACTGCCTAAGTGAGGCGGGTTCTTCTCCGCGAAGAGTCATAGGGGAAATTTCTTTAGAAGACGTACACTTTAGTTACCCATCTCGTTCGGATATTAAGATCTTGAAGGGATTTTCTCTTCACATAAAACCCGGAGAAAGCGTGGCGTTGGTTGGCTCATCTGGTTGTGGCAAATCAACTATACTCCAACTCCTGCAAAGGCTATACGATCCTAATCAAGGCTCCGTGAAACTAGACGGGAGAAATTTGAAAACTCTAAACATAGGATGGCTACGATCTTCGTTGGGTGTGGTAGGACAAGAGCCTGTCCTTTTTCGAGGAACGATTTACGATAATATAGCCATTGGGTATCCAGAAGCAACAAGTGAAGATGTTTACAGAGTAGCAGAAATGGCTTATGCACATGAATTCATCAAGAATTTACCAAACGGCTATGAAACAGTGATAGGTGAGCGTGGAGCCTCATTATCCGGCGGTCAGAAACAACGCATAGCCATAGCACGATCACTTCTACGTGAACCAGCTGTTCTGCTGTTAGATGAAGCTACTTCAGCATTAGATCCTCACTCCGAAAAACAAGTTCAAGCTGCATTGGACAGAGCAAGCGTTGGCAGAACCACACTAACAGTCTCACACAGATTGTCGACTATCGTGAATTGCCATCGAATTATTTGCATGGATCAAGGAACTATTATTGAGCAAGGGACTCATGTTGAACTGATGAAGGCCAAAGGTTTTTATCACAAACTAGTTACCAGCGGAAAAGAGACCAAAGAGCCAGAAGAAATTGGAACGGTGCTGGAAGAACAAGAAACAAAACAAAATGGCGAACTTCAGCCAGCGGTGCGACCCGAACCAGATGTCAAAAGACGATCTGTAAGGAAACTTCACAGGCGTCAGTCCGCCAAAGGAGCTCACGAATGGATGGCTACACCACGAGGGTCAATTTCCTCAATTATGTCAACAGCCTTACAAAGCCACGCTTACAGCGACACTTATGAAGTAGAAGAATTTGATGACGATGAGGACGTGACCCCGGTTAGTGATTGGCAGCTTCTGAAGCTTAATACACCCGAGTGGCTCTATCTTACAGTCGGATCCATTGCAGCTTTCATTCAAGGAGCCTGCTTTCCTGTTTTCGCTTTACTATTGGGCTACACAAGTGGTATTTTTATTTTGCCAGACGAGAACGAAGTTTTATATTTTGCGGACTTATATTCTGGACTGTTTCTCGTTGTGGCCGCAGTTGCTGGTATATCTATGTGCATCCAAAGCAGTACATTTACCACTGCAGGATTAAAAATGACGACACGTCTTCGTTACAAGTATTTTTCGGCTTTGTTAAGACAAGAAATTGGTTACTTTGATAGAGAATCGAATACAGTTGGTGCCGTATGTGCAAGACTTAGTGGCGATACAGCAGAAGTACAAGGCGCTACTGGATTACGAATCGGTCTTATTTTGCAAGGATTCAGTTCGGTTACGGTTGGATTCATCATGGCAATGAGCTACAACTGGAAACTAACCCTCGTGTCTACAACATTTTTGCCTTTGATGGTTGGAAGTATTTGGTTGGAAGGTATAATGTCTCAAAAATCACAGCAAGATGAACGAGAAGCAATGGAATCTGCTACAGCGATCGCAACAGAAGCAGTAGTTAGCATCAAAACCGTTCAGAGCTTAGGTATTGAATCTTTGTTTATTACAAGATTTCAAGACGCACTGATAGACGCTTGTGCAGCTGTCGTGAAGAAGAGTCGTTGGCGGGGCTTAGTCCTTGGTTTGTGTATTTACGTTCCACTGCTGTCTTACTGCAGCGCTGTCATTTATGGAGCAGTTCTAGTCGCCCACGGGGAAGTCGAATACGAAGTTGTTTTACTTGTTACTGAAGCAGTGATGTACGGAGCATACATGCTAGGTCAGTCATTAGTATACGCACCGAGCTTCAATTCGGCAAAAACTTGCGGTGCAAGGATCTTATCTATTATAAACCGAGAGCCGAGAATCAGAACAGTAGACGGTCTCAACGATAAACAGGATTGGTCCGCATCAGGAAATTTCAGCATCAACGATGTCGAATTTAGTTATCCTACTCGAGCACATCAGATGATTCTCAAAGGTATTGACTTGCACGTAGAAGCCGGCAAAACTGTTGCCCTTGTTGGTTCATCAGGCTGCGGAAAATCAACAGTGTTGCAACTTATACAGAGATTCTATGATCCCACAACTGGAAATATTGAATTGGACGGTGTGGATATAACGAAAAGCTTAACACTGAATCGCCTCCGAAAACAACTTGGGGTGGTGCAACAAGAACCCATTTTGTTCGATCGCACCCTCGCAGAGAACATCGCGTACGGTGACAACAGTCGCAAACCTACTATGGATGAAATCATTGCAGCAGCTAAAGCGGCCAATATACACAATTTCATCGTATCTTTACCAAAGGGCTACGAAACGAACTTAGGAGCAGGCGGTGCTCAATTATCCGGAGGACAAAAGCAGCGAGTGTGCATAGCGCGGGCCCTCATCAGATCACCACGCCTACTCCTCTTGGATGAGGCAACTTCGGCTTTGGATGCCAACAGTGAACGGGCTGTAACAGAGGCATTGGATCATGCAGCCAAAGGCCGAACTTGCATTACTATAGCTCATCGTCTAACTACAATCAAGGACGCTGATATCATTTGTGTTTTGGATAAAGGTAAAATAGTAGAAAAAGGCAACCACGCAGAGCTCATTGGCCTCAAGGGACATTACTGGCAACTAAGTAAACAGCAAAACGTCACGTGA
Protein
MGVKKEKKIKLEENIVESSLSFFQIFRYATWLELTATILGTVFGLLSAGGVTYNLMQVGEMSTAFVERTVPPDRLTSKMPIMSLFGGGRRLYNATHEENMAALIEDAQAVAIGAFVSIIFSILCNVLSVALVSWSALKQITTIRKLFLTAVLRQDMTWFDTDSDFNLASKMSENLMKLKEGMGEKLAVVSNLVGTSIICLCTAFPLGWKLALACITVMPFSIMASVALTNYQTKSSIREMESYSQAGKQAEEVLKSVKTVVAFGGENIEVQRYKSLLEPAEISGSRRGLFTGLGNGFNWVLTYSLNTIGFMYGTRLIIEDANKPDDERTYIIGIVLSITFSVYMATQSITLCVPHMEVFATARGAAASIFSLLDKHPKIDCLSEAGSSPRRVIGEISLEDVHFSYPSRSDIKILKGFSLHIKPGESVALVGSSGCGKSTILQLLQRLYDPNQGSVKLDGRNLKTLNIGWLRSSLGVVGQEPVLFRGTIYDNIAIGYPEATSEDVYRVAEMAYAHEFIKNLPNGYETVIGERGASLSGGQKQRIAIARSLLREPAVLLLDEATSALDPHSEKQVQAALDRASVGRTTLTVSHRLSTIVNCHRIICMDQGTIIEQGTHVELMKAKGFYHKLVTSGKETKEPEEIGTVLEEQETKQNGELQPAVRPEPDVKRRSVRKLHRRQSAKGAHEWMATPRGSISSIMSTALQSHAYSDTYEVEEFDDDEDVTPVSDWQLLKLNTPEWLYLTVGSIAAFIQGACFPVFALLLGYTSGIFILPDENEVLYFADLYSGLFLVVAAVAGISMCIQSSTFTTAGLKMTTRLRYKYFSALLRQEIGYFDRESNTVGAVCARLSGDTAEVQGATGLRIGLILQGFSSVTVGFIMAMSYNWKLTLVSTTFLPLMVGSIWLEGIMSQKSQQDEREAMESATAIATEAVVSIKTVQSLGIESLFITRFQDALIDACAAVVKKSRWRGLVLGLCIYVPLLSYCSAVIYGAVLVAHGEVEYEVVLLVTEAVMYGAYMLGQSLVYAPSFNSAKTCGARILSIINREPRIRTVDGLNDKQDWSASGNFSINDVEFSYPTRAHQMILKGIDLHVEAGKTVALVGSSGCGKSTVLQLIQRFYDPTTGNIELDGVDITKSLTLNRLRKQLGVVQQEPILFDRTLAENIAYGDNSRKPTMDEIIAAAKAANIHNFIVSLPKGYETNLGAGGAQLSGGQKQRVCIARALIRSPRLLLLDEATSALDANSERAVTEALDHAAKGRTCITIAHRLTTIKDADIICVLDKGKIVEKGNHAELIGLKGHYWQLSKQQNVT

Summary

Catalytic Activity
ATP + H(2)O + xenobiotic(Side 1) = ADP + phosphate + xenobiotic(Side 2).
Similarity
Belongs to the ABC transporter superfamily. ABCB family. Multidrug resistance exporter (TC 3.A.1.201) subfamily.
Keywords
ATP-binding   Complete proteome   Glycoprotein   Membrane   Nucleotide-binding   Polymorphism   Reference proteome   Repeat   Translocase   Transmembrane   Transmembrane helix   Transport  
Feature
chain  Multidrug resistance protein homolog 49
EC Number
7.6.2.2
EMBL
BABH01007213    BABH01007214    HQ116793    ADV76538.1    HQ116794    ADV76539.1    + More
AGBW02015069    OWR40605.1    KQ459605    KPI91945.1    KQ461196    KPJ06356.1    NWSH01002654    PCG67759.1    NWSH01006407    PCG63464.1    BABH01007211    GAIX01014073    JAA78487.1    PCG63463.1    ODYU01006047    SOQ47556.1    ODYU01006552    SOQ48494.1    AGBW02011924    OWR45901.1    CVRI01000043    CRK95982.1    KQ458863    KPJ04743.1    GL443280    EFN62270.1    KQ414636    KOC67015.1    JXJN01021173    KK107488    EZA49880.1    QOIP01000012    RLU15877.1    UFQT01000131    SSX20626.1    UFQT01000028    SSX18184.1    KQ459593    KPI96347.1    BABH01009789    BABH01009790    KQ458751    KPJ05317.1    CM000158    EDW90685.1    CM002911    KMY93381.1    KZ149962    PZC76282.1    M59076    AE013599    AY058791    BT044206    BT081353    BABH01023141    BABH01023142    BABH01023143    BABH01023144    CH480816    EDW47652.1    AGBW02012702    OWR44581.1    GDIQ01182550    JAK69175.1    GDIQ01182548    JAK69177.1    GDIQ01182551    JAK69174.1    GDIQ01182552    JAK69173.1    GDIQ01182547    JAK69178.1    GDIQ01182549    JAK69176.1    GDIQ01154249    JAK97476.1    GDIQ01147811    JAL03915.1    GDIP01148275    JAJ75127.1    GDIP01064791    JAM38924.1    GDIP01109174    JAL94540.1    GDIQ01147810    JAL03916.1    GDIP01148276    JAJ75126.1    GDIP01066181    JAM37534.1    GDIP01219361    GDIP01219360    JAJ04042.1    GDIQ01111964    JAL39762.1    GDIQ01126919    JAL24807.1    GDIQ01147809    GDIQ01062282    GDIQ01051648    JAN32455.1    GDIQ01063940    JAN30797.1    GDIQ01147812    JAL03914.1    GDIP01148277    JAJ75125.1    GDIP01232016    JAI91385.1    GDIQ01219679    JAK32046.1    GDIP01148274    JAJ75128.1    GDIQ01098175    JAL53551.1    GDIQ01236626    JAK15099.1    GDIQ01206138    JAK45587.1    GDIQ01117914    JAL33812.1    GDIQ01237733    JAK13992.1    GDIQ01027999    JAN66738.1    GDIQ01237732    JAK13993.1    GDIQ01206136    JAK45589.1    GDIQ01098174    JAL53552.1    GDIP01146971    JAJ76431.1    GDIP01186914    JAJ36488.1    GDIQ01206137    JAK45588.1    GDIQ01100931    JAL50795.1    CH902619    EDV36373.1    GDIQ01081174    JAN13563.1    GDIQ01163316    JAK88409.1    GDIQ01069836    JAN24901.1    GDIP01146973    JAJ76429.1    GDIQ01166203    JAK85522.1    GDIP01146919    JAJ76483.1    GDIQ01035348    JAN59389.1    GDIP01146924    JAJ76478.1    GDIP01046831    JAM56884.1    GDIP01168463    JAJ54939.1    GL732532    EFX85237.1    GDIP01146922    JAJ76480.1    KK118129    KFM72297.1    GDIP01168462    JAJ54940.1    GDIP01146925    JAJ76477.1    GEZM01046271    JAV77371.1    GDIP01146972    JAJ76430.1    GDIP01167921    JAJ55481.1    GDIP01146920    JAJ76482.1    GDIP01146923    JAJ76479.1    GDIP01146921    JAJ76481.1    GDIP01064790    JAM38925.1    GDIQ01166204    JAK85521.1    KQ459986    KPJ18849.1    GDIP01073985    JAM29730.1    KF906269    AHK05634.1    GDIP01066179    JAM37536.1    JRES01000089    KNC34215.1   
Pfam
PF00005   ABC_tran        + More
PF00664   ABC_membrane
Interpro
IPR017871   ABC_transporter_CS        + More
IPR039421   Type_I_exporter       
IPR003439   ABC_transporter-like       
IPR027417   P-loop_NTPase       
IPR011527   ABC1_TM_dom       
IPR003593   AAA+_ATPase       
IPR036640   ABC1_TM_sf       
IPR030275   MDR3       
IPR030278   BSEP       
SUPFAM
SSF90123   SSF90123        + More
SSF52540   SSF52540       
Gene 3D
PDB
6QEX     E-value=0,     Score=2238

Ontologies

Topology

Subcellular location
Membrane  
Length:
1309
Number of predicted TMHs:
12
Exp number of AAs in TMHs:
256.776850000001
Exp number, first 60 AAs:
22.52924
Total prob of N-in:
0.99508
POSSIBLE N-term signal
sequence
inside
1  -  30
TMhelix
31  -  53
outside
54  -  109
TMhelix
110  -  132
inside
133  -  185
TMhelix
186  -  208
outside
209  -  211
TMhelix
212  -  231
inside
232  -  295
TMhelix
296  -  318
outside
319  -  330
TMhelix
331  -  353
inside
354  -  738
TMhelix
739  -  761
outside
762  -  789
TMhelix
790  -  812
inside
813  -  860
TMhelix
861  -  883
outside
884  -  886
TMhelix
887  -  904
inside
905  -  970
TMhelix
971  -  993
outside
994  -  1002
TMhelix
1003  -  1025
inside
1026  -  1309
 
 

Population Genetic Test Statistics

Pi
26.726457
Theta
26.575943
Tajima's D
-1.054731
CLR
0.07537
CSRT
0.127743612819359
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号