SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00396  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA000724
Annotation
ATP-binding_cassette_sub-family_B_member_3_[Trichoplusia_ni]
Full name
Multidrug resistance protein 1B      
Alternative Name
ATP-binding cassette sub-family B member 1B
P-glycoprotein 1
Location in the cell
PlasmaMembrane   Reliability : 4.383
 

Sequence

CDS
ATGGCAAATAAGAAAAAGAAATCGAAGAATGAAGAAAACATCACGACGCTGGTGTCCTTCTTTCAAATCTTTCGTTACGGAAATTGTTTGGAGCTGTTGGCAACCGCTCTCGGGGTAGTCTTCGGAATGATAAGTGGAGCCGGCGTGTGCTGCAACCTGCTCCAAATAGGAGAACTGAGCACGGCGTTCGTTGAGAGGACTAAGTATCATGACCGGCTTTCCAGCTACTTGCCGCTGACTGCGACTTTCGGAGGTGGCAAAAGATTGGTTAACGCTACGCACGAACAAAATATGGAGGCTCTTATCGATGACGCGAAAGCAATGGCCATCGGAATGTTCATCAGTATTGGAGTATCTCTTGTGTTCTGCGTGCTGTCCTTCAGCCTAATCAGTTGGAGCGCTTTACGCCAGATAACGAGAATAAGGACGTTGTTCCTGAGGTCTGTACTTCGTCAAGACATGTCTTGGTACGACACTGATTCAGAATTCAACTTAGCGTCGAAGATGTCCGAAAACTTGATGAGCATTAAGGAAGGTATGGGCGAGAAGTTGGCGGTTGTATCGAACTTGGTGGGGACTTCCGTGATTTGTCTGTGCACCGCATTCCCCCTCGGTTGGCAGTTGACTCTGGCCTGCGCAGCCGTGATGCCCTTCTCCGTGATCACTTCTATTGCCTTATCGAATTACCAAACAAAGTCTTCGATAAGAGAAATGGAATCATACAGTTTGGCCGGCAAGCAAGCTGAAGAGATTCTCAAGTCGGTCCGAACAATCGTCGCCTTCGGAGGGGAAAATAAGGAAGTAGAGCGGTACCGACGTCTGCTTGAGCCGGCTGAAGAATTTGGTCGAAAACGTGGTCTTTTCACGGGATTAGGCAACGGCTTCAACTGGGTCCTTACATATTCTCTGAATGCTATCGGCTTTTCGTACGGGACAAGGCTAGTTGTCAATGATTTCGATACTGATTCTAATTTGAGGCAATATCCCGTTGGCGCTGTGTATAGTATACTATTCTCTGTATATATGGCAACACAGTCTATTACATTCTGTGTCCCACATTTGGAGGGCTTCGCCGCGGCCCGTGGTGCGGCCGCAAGCATTTTCCACTTGATTGAAAGAGAACCAAAGATCGACAGTCTACAGCAAAAAGGTTTAACGCCTCGTCGAGTTGTTGGAGATATTTTACTTGAGGACGTTGAGTTCTGTTATCCGTCGCGACCCGAAGTCAAGGTTCTCAAAGGTTTTTCGATCCACGTAAAGCCGGGCGAATGCGTAGCTCTAGTGGGCTCCTCTGGTTGCGGTAAAAGTACTGTATTACAACTTTTACAAAGACTGTACGACCCACAAGCCGGCTCAGTTAAACTGGATGGTAAAAATTTGAAAAACCTCAATCTTAGCTGGCTGAGGTCATCTTTGGGTGTGGTAGGTCAAGAACCAGTACTGTTTCGAGGGACGATCTACGACAACATCGCCATCGGAAGTCCAGAGGCCACACGCGAAGAAATCCAAAGAGTCGCTGAGATTGCTTACGCCCATGACTTTATTAGTCTTCTACCAAATGGCTACGATACTGTGATAGGAGAACGAGGCGCTTCTCTTTCTGGTGGTCAGAAGCAACGAATTGCAATTGCCCGGTCTCTCTTACGTGAACCGGCGGTGCTACTGCTTGACGAGGCTACTTCAGCCCTTGACCCTCACTCTGAGAGACAAGTACAAGCAGCGCTCGATCGTGCCAGTGTCGGACGCACTACCATAACCGTGTCACATAGATTGTCGACCATAGTGAACGCCGATAGAATTATTTGCATGGACCAAGGAGTTATAGTCGAACAAGGAACGCACGAGGATCTCATGAAAGCCAAAGGGTTTTACCATAAACTGGTGACAACTGGTAACGAGAACAAAGAACCAGCAGATATAGAGCCCCTTATTGAGGAAGCTGACGGTGATGGAGACAACATAGAACCAACTGTACCTTCAAGATTAGACGTCAGACGACGATCAAGTAAGAAAGTGCTGAGACATCATTCTATTAAAAAAGATCACCCGGACTGGTTGACACCTCGCGGCTCGATTTCTTCAATGGTATCGATTGGACTGCAAAATTTCGTATTTAATAGTGATCTCGAATCTGAGGAAGATGAAGACGAAGAAGAGACTGTAAAAACTGTCAGTGATTGGCAGCTACTGAAATTGAATGCCCCTGAATGGCCATTGATAACAGTTGGCTCTATTGCTGCTTTCCTACAAGGAGCATGTTTCCCTGTCTTCGCCTTACTTTTTGGATTTTCCAGCGGGATCTTCATACTAGATAATCGCGATGATATCATTTATTTAGCAGATCTTTATTCTGTGTTATTCGTGGTGATAGCCGCGGTTGCTGGTATATCCATGTGTCTACAAAGTACAACCTTTACAAGCGCTGGCTTGAAAATGACAACTCGACTAAGACATCAATATTTTGCATCTTTGTTGAAACAGGAAATAGGGTTTTTCGATAAAGAAACGAATACGGTCGGCGCGATCTGTGCGAGATTGAGCGGTGACACTGCTGAGGTACAGGGTGCCACTGGACTCAGGATAGGCCTCATACTGCAGGGTATAAGCTCAGTGGTCGTCGGGTTTTTGTTAGCTATCAGCTACAACTGGAAACTTACCTTAGTTGCGACAGTTTTTCTTCCTTTGATGGTAGGTAGTATATGGTTGGAAGGTATTATATCTCAGAAGGCGCAAATAGATGAACGAAATGCAATGGAATCAGCCACTGCCATAGCTACTGAAGCCGTTGTCAGCATCAAGACAGTGCAGAGCTTAGGTGTGGAGACGGTTTTCCTCCAAAAATTTCAAGATGCACTCAAGACTGCCTGTGTAGCTGTGGCTTATAAAACGCGTTGGAGAGGATTAGTCTACGGTCTTGGAGTTTACATACCGTTCATGGCGTACTGTAGCGCTACTGTTTACGGCGCCGTGCTCGTCGCCTATGGAGAAATGGAATATAAACTAGTGTTGCTGGTAAACGAAGCTATAATGTACGGAGCCTACATGTTAGGCCAGTCGCTGGTGTATGCTCCCAGTTTGAATACGGCAAAGGCGTGTGGAGCAAGGATTCTGTCCATCATTCAAAGGCAACCTAAAATTCACAACGCAGTTGGAGTGAAAGACAAAAAAGATTGGGTGGCGTCCGGAAACTTCAGCATGCGTGATGTAGAATTCTGTTACCCTACAAGGCCAAGTCAACGTGTTTTGAAAGGAATCGATCTGAAAATGGAAGCTGGTAAAACCATCGCTCTCGTCGGGTCCTCCGGATGTGGCAAGTCTACAATCCTCCAGCTATTTCAACGTTTCTATGACCCTGATTCTGGTTTTATTGAATTAGACAATCGTGACATTAGATCTGCTCTGACTATACCACGGCTGCGTCGTCAGTTAGGAGTCGTGCAGCAAGAGCCGGTGCTCTTGGACAGAAGTCTGGCCGAGAATATCGCGTATGGAGATAACAATAGGAAGGTCACTATGCACGAAATCGTCGCCGCTGCCAAAGCAGCAAACATACACTCATTCATCGTGTCTTTACCCAAGGGTTATGAAACGAATTTGGGTGCGAACGGTGCTCAGCTGTCAGGAGGTCAAAAACAGCGGGTCTGTATAGCAAGGGCACTCATTAGGTCGCCACGCTTGTTACTGCTAGATGAAGCTACATCAGCATTGGATGCTAGCAGTGAACGGGCCGTGACAGAAGCTTTGGAGAAGGCTGCCAAGGGCCGCACTTGCATCACTATTGCTCACCGCCTCTCTACAGTTAAAGACGCTGACTTGATCTGCGTTATTGATAAAGGTAAAATCGTTGAGCGTGGAACTCATGCTGAATTGGTCAGCATGAAGGGACATTACTGGCGCATGTGTAGAGGCCAAAATATGGCTTAA
Protein
MANKKKKSKNEENITTLVSFFQIFRYGNCLELLATALGVVFGMISGAGVCCNLLQIGELSTAFVERTKYHDRLSSYLPLTATFGGGKRLVNATHEQNMEALIDDAKAMAIGMFISIGVSLVFCVLSFSLISWSALRQITRIRTLFLRSVLRQDMSWYDTDSEFNLASKMSENLMSIKEGMGEKLAVVSNLVGTSVICLCTAFPLGWQLTLACAAVMPFSVITSIALSNYQTKSSIREMESYSLAGKQAEEILKSVRTIVAFGGENKEVERYRRLLEPAEEFGRKRGLFTGLGNGFNWVLTYSLNAIGFSYGTRLVVNDFDTDSNLRQYPVGAVYSILFSVYMATQSITFCVPHLEGFAAARGAAASIFHLIEREPKIDSLQQKGLTPRRVVGDILLEDVEFCYPSRPEVKVLKGFSIHVKPGECVALVGSSGCGKSTVLQLLQRLYDPQAGSVKLDGKNLKNLNLSWLRSSLGVVGQEPVLFRGTIYDNIAIGSPEATREEIQRVAEIAYAHDFISLLPNGYDTVIGERGASLSGGQKQRIAIARSLLREPAVLLLDEATSALDPHSERQVQAALDRASVGRTTITVSHRLSTIVNADRIICMDQGVIVEQGTHEDLMKAKGFYHKLVTTGNENKEPADIEPLIEEADGDGDNIEPTVPSRLDVRRRSSKKVLRHHSIKKDHPDWLTPRGSISSMVSIGLQNFVFNSDLESEEDEDEEETVKTVSDWQLLKLNAPEWPLITVGSIAAFLQGACFPVFALLFGFSSGIFILDNRDDIIYLADLYSVLFVVIAAVAGISMCLQSTTFTSAGLKMTTRLRHQYFASLLKQEIGFFDKETNTVGAICARLSGDTAEVQGATGLRIGLILQGISSVVVGFLLAISYNWKLTLVATVFLPLMVGSIWLEGIISQKAQIDERNAMESATAIATEAVVSIKTVQSLGVETVFLQKFQDALKTACVAVAYKTRWRGLVYGLGVYIPFMAYCSATVYGAVLVAYGEMEYKLVLLVNEAIMYGAYMLGQSLVYAPSLNTAKACGARILSIIQRQPKIHNAVGVKDKKDWVASGNFSMRDVEFCYPTRPSQRVLKGIDLKMEAGKTIALVGSSGCGKSTILQLFQRFYDPDSGFIELDNRDIRSALTIPRLRRQLGVVQQEPVLLDRSLAENIAYGDNNRKVTMHEIVAAAKAANIHSFIVSLPKGYETNLGANGAQLSGGQKQRVCIARALIRSPRLLLLDEATSALDASSERAVTEALEKAAKGRTCITIAHRLSTVKDADLICVIDKGKIVERGTHAELVSMKGHYWRMCRGQNMA

Summary

Catalytic Activity
ATP + H(2)O + xenobiotic(Side 1) = ADP + phosphate + xenobiotic(Side 2).
Subunit
Interacts with PSMB5.
Miscellaneous
In mouse the MDR gene family includes three or more related but distinct cellular genes.
Similarity
Belongs to the ABC transporter superfamily. ABCB family. Multidrug resistance exporter (TC 3.A.1.201) subfamily.
Keywords
ATP-binding   Cell membrane   Complete proteome   Glycoprotein   Membrane   Nucleotide-binding   Phosphoprotein   Reference proteome   Repeat   Translocase   Transmembrane   Transmembrane helix   Transport  
Feature
chain  Multidrug resistance protein 1B
EC Number
7.6.2.2
EMBL
BABH01007211    HQ116793    ADV76538.1    HQ116794    ADV76539.1    NWSH01002654    + More
PCG67759.1    AGBW02015069    OWR40605.1    KQ459605    KPI91945.1    KQ461196    KPJ06356.1    GAIX01014073    JAA78487.1    NWSH01006407    PCG63464.1    PCG63463.1    ODYU01006552    SOQ48494.1    BABH01007213    BABH01007214    ODYU01006047    SOQ47556.1    BABH01009789    BABH01009790    CH963846    EDW72340.2    AGBW02012702    OWR44581.1    GL732530    EFX86431.1    JRES01000089    KNC34215.1    CCAG010019770    BC141363    BC150811    CH466600    AAI41364.1    EDL14680.1    M14757    M60348    AAQR03012497    AAQR03012498    AAQR03012499    AAQR03012500    JX312084    AFR33964.1    AM491812    CAM33439.1    AABR07059500    AABR07059501    AABR07059502    AABR07059503    AABR07072972    AC133679    AF257746    CH474013    AAF69007.1    EDL84318.1    U78609    AAB58489.1    AY582535    AAS91649.1    AAGW02061966    AAGW02061967    AAGW02061968    KR905170    AKZ42358.1    DS985243    EDV26959.1    AY360144    AAQ63650.3    AEYP01005833    JQ696953    AFV15804.1    KK718434    KFO56227.1    MCFN01000033    OXB67674.1    HG917089    CDM63410.1    CM004478    OCT71794.1    CH379067    EDY73278.1    AAKN02015613    AAKN02015614    AAKN02015615    AAKN02015616    HG917090    CDM63411.1    AADN05000033    KP663379    AKN23386.1    MUZQ01000073    OWK59687.1    AKHW03005461    KYO26786.1    AMQN01003653    AMQN01003654    KB312379    ELT87338.1    AJ009799    CAA08835.1    KB632345    ERL93126.1    AAKN02016682    AAKN02016683    AAKN02016684    LSMT01000057    PFX30016.1    FJ938210    ACX30417.1    MH420553    AYM45157.1    QUSF01000003    RLW11219.1    KK378712    KFV47214.1    AERX01017567    CM004474    OCT79361.1    KZ505638    PKU49436.1    AGTO01011562    JW861206    AFO93723.1    KK718916    KFO59998.1    KL870333    KGL87620.1    AADN05000350    CR626882    CM004476    OCT75761.1    AYCK01002214    ADON01068769   
Pfam
PF00664   ABC_membrane        + More
PF00005   ABC_tran
PF17833   UPF0113_N
PF03657   UPF0113
Interpro
IPR036640   ABC1_TM_sf        + More
IPR011527   ABC1_TM_dom       
IPR027417   P-loop_NTPase       
IPR003439   ABC_transporter-like       
IPR017871   ABC_transporter_CS       
IPR039421   Type_I_exporter       
IPR003593   AAA+_ATPase       
IPR030258   MDR1       
IPR030275   MDR3       
IPR030278   BSEP       
IPR015947   PUA-like_sf       
IPR040598   UPF0113_N       
IPR036974   PUA_sf       
IPR002478   PUA       
IPR005155   UPF0113_PUA       
SUPFAM
SSF52540   SSF52540        + More
SSF90123   SSF90123       
SSF88697   SSF88697       
Gene 3D
PDB
6QEX     E-value=0,     Score=2317

Ontologies

GO
GO:0016021   GO:0005524   GO:0042626   GO:0015721   GO:0097254   GO:0017085   GO:0001666   GO:0008354   GO:0005886   GO:0099038   GO:0009986   GO:0072089   GO:1901529   GO:0000086   GO:0090555   GO:0047484   GO:0016324   GO:0090554   GO:2001225   GO:0014045   GO:0061843   GO:0042493   GO:0005739   GO:0005215   GO:0000139   GO:0046581   GO:0043278   GO:1902065   GO:1904478   GO:0006855   GO:1905233   GO:0071407   GO:0071312   GO:0071475   GO:0033762   GO:2001025   GO:1905231   GO:0016020   GO:0071549   GO:0071217   GO:0009914   GO:0001890   GO:0032355   GO:0036146   GO:0071548   GO:0014072   GO:0031526   GO:0010033   GO:0046618   GO:0071392   GO:0033189   GO:1990962   GO:0050892   GO:0046686   GO:0071236   GO:0060548   GO:1904446   GO:0007623   GO:0032496   GO:0045177   GO:1902396   GO:0033231   GO:0097068   GO:1905235   GO:0007420   GO:0007595   GO:1903416   GO:0060856   GO:1905232   GO:0010046   GO:1990963   GO:0043215   GO:0033280   GO:0035633   GO:0014070   GO:1905237   GO:0031667   GO:0097327   GO:0009636   GO:0005925   GO:0005654   GO:0005829   GO:0061092   GO:0055088   GO:0032376   GO:0015629   GO:1903413   GO:1901557   GO:0032782   GO:0006703   GO:0008584   GO:0048568   GO:0008585   GO:0003723   GO:0015462   GO:0019534   GO:0015562   GO:0015722   GO:0015126   GO:0006810   GO:0016887   GO:0043401   GO:0003677   GO:0003707   GO:0007169   GO:0055085  

Topology

Subcellular location
Cell membrane  
Length:
1307
Number of predicted TMHs:
9
Exp number of AAs in TMHs:
241.205150000001
Exp number, first 60 AAs:
22.45419
Total prob of N-in:
0.99265
POSSIBLE N-term signal
sequence
inside
1  -  33
TMhelix
34  -  56
outside
57  -  109
TMhelix
110  -  132
inside
133  -  183
TMhelix
184  -  206
outside
207  -  747
TMhelix
748  -  770
inside
771  -  782
TMhelix
783  -  805
outside
806  -  855
TMhelix
856  -  878
inside
879  -  884
TMhelix
885  -  907
outside
908  -  971
TMhelix
972  -  994
inside
995  -  1000
TMhelix
1001  -  1023
outside
1024  -  1307
 
 

Population Genetic Test Statistics

Pi
22.30863
Theta
22.667174
Tajima's D
-0.656838
CLR
0.008288
CSRT
0.209139543022849
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号