SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00385
Annotation
PREDICTED:_uncharacterized_protein_LOC106720812_[Papilio_machaon]
Location in the cell
Mitochondrial   Reliability : 1.373 Nuclear   Reliability : 1.496 PlasmaMembrane   Reliability : 1.154
 

Sequence

CDS
ATGCCGACAAACCCTGCGACTAGTACTGGTTTGCAAGTTAATATTATACAACCTAGTACTTCCCAACATGTAGACAGCATTGCTCCGAGTGAGACGTCTAAGTCAAAATCATCACGCTCGTCATCCACAATTAAGGCTCAAAAGGCCGCCGTAGAGGCCCTCGCCCTGCGCCGACGTCTTGAGCACGAGCAGGAGTTGGCTGAACGTGAGAGGCAACGTGAAAGTCGACTGGCAGCACTCCGTCAGCAGGTAGAGGAGGGCGAACTGAAGGCCGAACTTGCCGCTCTCGACGCGGAAGCCGCGGCAAGTCACAGCAGTCGCAGTGGTTCTGCCAGGGTAAGCGTAGAAAGAACAGAAAGATGGGTACAAAGTTTAGAACAGCCAGTTTGCGTTGGCGAAAATACAGTTAATAGAGGCATTCCCGCAGTAGGGCGAGAGCAAGTAGTGGTTCCGCCTCCCGGCCACCAGGCACCTCTGCCGGCCACTGGGTCAACTGCATCCCCTGTTAACCGTTTTGTTCATCAGAAACAACTTTTAAACGTCACTAAAGCGTCCGAGGCGGCCGTACTTACGCGACCGCTCATTTCCACGGAGGTTGATCAGAGTAGTCTGCTTCAGGCTGTTGCTGACACTGCAGCTGCGGCCAAGGCGCTTGCTACTTCGCACCGTCATAAACATAAGATCGAATTGTTTCCTTTCGACGGAGACGCCTTAACATGGCTACATTTCAAACGTATTTTTGATTTAACCAAAAACAATTTTTCAAATATTGAAAATATTAGTCGGTTACAAAATGCACTTCGCGGCGCGGCCCGAGATGCAGTCGCGTCACTGTTGCTGGCTACAGACAACCCGAACGACATTATAAGAGCTCTGGAGGAGAACTTCGCTCGCCCGGAAATTATAGTATTTAAGGAAGTCTCCGCTCTTAAAAATCTACCACGTTTGGGAAATGACTTGAAAGAGTTAATTACGATAACGAATAAGGTACGTAATTCTATATCTTCTTTTAAAATACTGAATAAAATTGAGTACTTGCATTCTCCAGAACTATTTCACGCCGTCTTAGGAAAATTAAACCCGGTTACTAAAGTAAGATGGACGGACTTTGCTATGCAAGATACTACAGGACGTCCTAAATTAGAAATTATGTCCGATTTTTTGAGGCGCGAGTTAGATCAACTTATTCGGTTCGGTTTATCACCGGAATCTTGCTCGATCCAACATTCACCAGAAAACACTCATCTAAACAAACCGTATAAACGGGAAAATATTCACATAGTTACACACTCTAAACTAAATTCTAATGCGGCGTCTACACAAAAGCTTGAATGCGCGTTTTGCAAAAAAGATCACAATATTAAGTCATGTTCTGAGTTCAAAGCCTTATCTGTTGATGAAAGGTGGGTCTGGCTGCGTGAGGTAAAAGCGTGTTATAGATGTCTTAGGCGTAGTTCACATCAGTGGAAAACATGTAAAGTTAACCCTTGTGGTGTTGATGGGTGTCTAATACGTCATCACCCGTTAATGCATGGTAAAGAACCTGTCTCTTCTGTCAATACTATGTTCGACACGCGATCCACCGAAAATGATCATACGACTAAGCACCACGAACCTGCATCTGTCGAAAAGGTAATAGTTTCTACCACTTCTACAGGTGTTCAAGAACCCAGCTCCATCTTAACTCTGTGCCCACGTGTATTTCTGAAAATCTTACCCGTTACTGTCTCTGGTCCCTCAGGAAGTTGCAATGTTTACGCACTTCTCGATGACGGTAGCACTGCTACGCTCATTGACTCAAGTATTGCTACTCAAATCGGTGCGACAGGGCCTCACCAGAAAATAACGGTTAATGGTATAGGCGGTCTCAGTAGAAACGCTACGATATCGTATGTAGATTTTCACATTAAGGGTAGGCACACACGAGACACATTTTTAGTGAAAAATGCGAGAGCTATGGAGTCTTTGTCTCTGCGTCCTCAAACGATTAGGCAGGAAACTATTGCTTCTTTCGCACATTTAGCGAATTTACCTTGCAACGTAACTTATGAAGATGCTACACCAACAGTTTTAATTGGTGCAGAGCATTGGCATTTGTCAATCAGCAGCGAGGTACGGTGTGGTGGTAAGAATGAACCCGTTGCCTGTTTAACTGCCTTAGGCTGGGTGCTTTATGGAATCGCGTCCAGTAAAACTAAATCAGTGGAGTTTGTTAATCACGGTGTGTGTATCGAACCTTCCGATGAGGAGAAATTAGACTCTTTTATTAAGGAACAATACAAAATTGATTCATTAGGTATTTCTAAAAAAGAAACTCTACATTCTAAGTCAGATAAACGTGCAGTCGAGATTTTAGAAAAAACTGCTAGACGTCTCCCCACTTCTGGTCGATTTGAGGTGGGTTTGCCGTGGCGTGACGATATACAACGCATTCCCGACAGCTACCTTCAAGCCATGTCACGATTTTTAAGTCTAGAAAGGCGCATGGCTAAAGATGCTGACTTTGCAAAAGCATATGACGTGTTCATTTCAAACATGATCGCTAAAGGCTATGCAGAAGAATGTGCTCCCGAGTCATACTACGCCAACCACATTAAAGATAAACAATCTTCTTTTATGAGGCTCTATTTACCCCATTTTGGCGTGTATCACCCTCAGAAACGTAAGCTTCGTGTAGTTCACGACGCCGCAGCCACGAATGCGGGCGTCAGCCTAAACTCTTTGTTGCTACCTGGTCCAGACCTGCTTCAGTCCTTGTTAGGTATTTTACTTCGGTTTCGCGAGGGCCGTATTGCTCTCACTGCTGATATCCGGGAAATGTTCCCTCAAGTAAGGATCAGAGAGCAAGATAGGGACGCCCTCCGGTTTCTCTGGAGGTCAAGCAGAGACCAACCTATAAAGGAGTTTAGGATGACAGCCATCATTTTCGGTGCGTGCTGCAGTCCATTTATAGCGCAATTTATTAAAAATAAAAACGCTCGTGAGCACGAAAGTTTATTTCCTAAAGCAGCTCATGCTATTTTGTACAATCATTATATGGACGATTATATTGACTCTCTCGATGACATTCAAGAGGCAGCACAACTAGCGGCGGATATTGTTGCCGTTCACAATGATGCCTACTTCGAGATGCGGGGCTGGATTTCCAACGATCCATCAGCGCTAAAATTTATTCCTGCTGATCTTAGGGCCACTCAACCGTCGTTGGAAATCAACCTTGGCAGCTGCTCTGTAAACAATATTAGAGCGTTGGGAGTATTGTGGAATCCCATAACAGATAATTTAGGGTTCCGCTCAGGCTTAGGTGAAACATTTCCAAACCCTCTCACAAAACGCAAAGTTCTTTGTCACCTCATGCGTGTGTACGACCCGTTAGGCTTATTAGCTCCAATAGTTGTTAAGGGTAGAATTTTATTTCAACAAACGTGGAGGTCTAATGTCGACTGGGACACCGAGTTCCAACCCACGGAAGCATTAAGATGGTCTGATTGGTTTCAGGAGTTGTCAAAAGTAACTTCTTTGGAAATTCCGCGTTGGTATTCTAACTCTAAAAACTCTGAACCAACTCAGAGGGAGTTCCACATTTTTGCTGATGCAAGTGAGCTCGCGTACGCATGTGTCGCTTATTGGCGCCTTTTGTACTCAGACGGCAGCATCGAGCTTTCTCTCATCTCTAGTAAGGCAAGAGTTACACCCTTGAAACCTATCTCTATCCCACGTTTAGAGCTCCAAGCCGCTTTAATAGCTTCTCGTCTCGCGGTCACCATTAAGGACAGTCATAGAAAACAACCGGCACATACTTTCTTTTGGACCGATTCTATGACAGTCCTTCAGTGGTTACGTAATGACGCGCGCTCTTTTAAGCCTTTTGTTGCCCATCGTTTAGGCGAAATTATTGAAAACTCTTGCGTCAGAGACTGGCGATGGATACCAACGGACTTGAATGTTGCCGACGACGCTACCAGAACGCGATCAATTAACCTCGACACGACCCACAGATGGTTTCGCGGTCCATCTTTTCTTTTTAAATCCGTTGAGGACTGGCCTACAGAGCCAAGGTTTGCCTCACCAAACACCGATGAACTTAAGACCAATAGTTATGAGTTGGTCGGACTAACTTCCTTTGTCGAAGAGTTACCGACTCCGGTCACAGCCATTTTTGCTAATTTTAGTAATTGGCAGCGCTTATTACGTGCCACAGCCCGGGTACTTCAAGCTGCGGCAAAGTTTGGTGTAATTTTGGCTTCCATTAGAAATTCTAAATTGAAAGGCGAAATTGTTTGTGCCCGCCATCCTTCAACGTCCACTACTCTGCCACCTCTTAGTGCAGATTTAATAAAGGCCGCCGAAAGGCAAATTATGCAACGAACACAGGTCGAGAGCTTTTCCATAGAATTTCTTCATATCCTGAACTCGAAGCCTATTCCTCCGAACAGTCGTCTCAGAAAACTGTCACCCGCTTTGGGAGAGGACAAGTTGCTGCGGTTAGCCGGAAGAATTAAAGCCGCAGAAGGCATTGACCCTGACACACGCTTCCCCATCCTTCTTGACGGTCGTCACCCAATTGTACGTTTATTGGTACAATTTTATCATCGAAAAGCGGGTCACGCAAATTATGAACTAGTCGTGAACGAATTAAGACAAAAATTCTGGTTGTTAAGACTGAGGAACACAGTGAGAACAGTAGCAAAAGAGTGTCCACTCTGCAGAATTAGAAAGTCCTTGCCGGTGAACCCGAAAACAGGAGATCTGCCACCTGAAAGATTAGCTCACCATCGACGGCCCTTTACTTTTACGGGTCTGGACTACTTCGGCCCCGTAAGCGTCACTATCGGGCGCAGGCATGAAAAACGTTATGTAGCCCTTTTCACCTGTTTAACTGTCAGAGCCCTTCACCTAGAAATGGTACATAGTCTATCGACTGACTCTGCTATCATGGCTATTAGAAGATTCATTGCAAGACGGGGCTGTCCAAACATTATTTTCTCGGACAACGGAACCTGCTTTGTTGGTGCCAATCGCATTCTCAGAGGTTTCTATGGAGAAAATGTCGAAGATTTCACAAGCACTCAAGGAATACTCTGGAAGTTCATCCCACCGGCGGCACCTAATTTCGGAGGATGTTGGGAGCGCTTGGTGCGATCAGTAAAGGTAGCTCTGAACGCAACATTAACCGAACGAGCTCCAAAAGAAGAAACCTTGAGCGTTTTACTAGCCGAGGCAGAAGCCATTGTCAATTCACGTCCATTAACTCATGTATCTACAGATCCTGACGACCCGACAACACTCACACCATTTCATTTCTTAATCGGTTCTTCGTCCGTGCAGACCTTACCTACTGCCTTGAACGATCACGATTTGGTCAGCCGTTCCGAATGGAGGAAAGCATTGAGGCTAGCGGATCATTTTTGGTCGCGTTGGATGCGCGAGGTTCTCCCGACCCTACAACCACGTGAGCAGTCAAGAGGCAACCGCAGTTCAACAGCTCTTCAAGAGGGTGACGTAGTAATTATTGCTGACTTCAACTTGCCCCGCGGAATATGGCCACGAGGACGTGTTGCGAAAGTGTACCCTGGGAAAGATGGCGTGATAAGGGTAGTGGACGTTGCAACAGCAGGGGGAATGCTACGCCGACCCGTACGAAAGCTGGTTAGGCTCTCCACCTAA
Protein
MPTNPATSTGLQVNIIQPSTSQHVDSIAPSETSKSKSSRSSSTIKAQKAAVEALALRRRLEHEQELAERERQRESRLAALRQQVEEGELKAELAALDAEAAASHSSRSGSARVSVERTERWVQSLEQPVCVGENTVNRGIPAVGREQVVVPPPGHQAPLPATGSTASPVNRFVHQKQLLNVTKASEAAVLTRPLISTEVDQSSLLQAVADTAAAAKALATSHRHKHKIELFPFDGDALTWLHFKRIFDLTKNNFSNIENISRLQNALRGAARDAVASLLLATDNPNDIIRALEENFARPEIIVFKEVSALKNLPRLGNDLKELITITNKVRNSISSFKILNKIEYLHSPELFHAVLGKLNPVTKVRWTDFAMQDTTGRPKLEIMSDFLRRELDQLIRFGLSPESCSIQHSPENTHLNKPYKRENIHIVTHSKLNSNAASTQKLECAFCKKDHNIKSCSEFKALSVDERWVWLREVKACYRCLRRSSHQWKTCKVNPCGVDGCLIRHHPLMHGKEPVSSVNTMFDTRSTENDHTTKHHEPASVEKVIVSTTSTGVQEPSSILTLCPRVFLKILPVTVSGPSGSCNVYALLDDGSTATLIDSSIATQIGATGPHQKITVNGIGGLSRNATISYVDFHIKGRHTRDTFLVKNARAMESLSLRPQTIRQETIASFAHLANLPCNVTYEDATPTVLIGAEHWHLSISSEVRCGGKNEPVACLTALGWVLYGIASSKTKSVEFVNHGVCIEPSDEEKLDSFIKEQYKIDSLGISKKETLHSKSDKRAVEILEKTARRLPTSGRFEVGLPWRDDIQRIPDSYLQAMSRFLSLERRMAKDADFAKAYDVFISNMIAKGYAEECAPESYYANHIKDKQSSFMRLYLPHFGVYHPQKRKLRVVHDAAATNAGVSLNSLLLPGPDLLQSLLGILLRFREGRIALTADIREMFPQVRIREQDRDALRFLWRSSRDQPIKEFRMTAIIFGACCSPFIAQFIKNKNAREHESLFPKAAHAILYNHYMDDYIDSLDDIQEAAQLAADIVAVHNDAYFEMRGWISNDPSALKFIPADLRATQPSLEINLGSCSVNNIRALGVLWNPITDNLGFRSGLGETFPNPLTKRKVLCHLMRVYDPLGLLAPIVVKGRILFQQTWRSNVDWDTEFQPTEALRWSDWFQELSKVTSLEIPRWYSNSKNSEPTQREFHIFADASELAYACVAYWRLLYSDGSIELSLISSKARVTPLKPISIPRLELQAALIASRLAVTIKDSHRKQPAHTFFWTDSMTVLQWLRNDARSFKPFVAHRLGEIIENSCVRDWRWIPTDLNVADDATRTRSINLDTTHRWFRGPSFLFKSVEDWPTEPRFASPNTDELKTNSYELVGLTSFVEELPTPVTAIFANFSNWQRLLRATARVLQAAAKFGVILASIRNSKLKGEIVCARHPSTSTTLPPLSADLIKAAERQIMQRTQVESFSIEFLHILNSKPIPPNSRLRKLSPALGEDKLLRLAGRIKAAEGIDPDTRFPILLDGRHPIVRLLVQFYHRKAGHANYELVVNELRQKFWLLRLRNTVRTVAKECPLCRIRKSLPVNPKTGDLPPERLAHHRRPFTFTGLDYFGPVSVTIGRRHEKRYVALFTCLTVRALHLEMVHSLSTDSAIMAIRRFIARRGCPNIIFSDNGTCFVGANRILRGFYGENVEDFTSTQGILWKFIPPAAPNFGGCWERLVRSVKVALNATLTERAPKEETLSVLLAEAEAIVNSRPLTHVSTDPDDPTTLTPFHFLIGSSSVQTLPTALNDHDLVSRSEWRKALRLADHFWSRWMREVLPTLQPREQSRGNRSSTALQEGDVVIIADFNLPRGIWPRGRVAKVYPGKDGVIRVVDVATAGGMLRRPVRKLVRLST

Summary

EMBL
KQ459986    KPJ18861.1    AF530470    AAQ09229.1    LNIX01000019    OXA44855.1    + More
LNIX01000007    OXA52015.1    LNIX01000003    OXA57597.1    LNIX01000015    OXA46575.1    JXUM01136032    KQ568367    KXJ69026.1    LNIX01000039    OXA39294.1    GAMC01017930    JAB88625.1    LNIX01000004    OXA55241.1    GEZM01052586    JAV74401.1    GGFL01001682    MBW65860.1    GGFL01001842    MBW66020.1    JXUM01127084    KQ567147    KXJ69602.1    GDHC01018323    JAQ00306.1    JXUM01111221    KQ565482    KXJ70922.1    LN877231    CTR11689.1    JXUM01038372    KQ561162    KXJ79503.1    GGFJ01000306    MBW49447.1    GGFJ01000333    MBW49474.1    GEHC01000947    JAV46698.1    KL367480    KFD71819.1    GEHC01000967    JAV46678.1    OXA56382.1    GGFL01005193    MBW69371.1    GEHC01000914    JAV46731.1    AAGJ04095911    GDIP01036233    JAM67482.1    GDIP01004568    JAM99147.1    GEHC01000921    JAV46724.1    GEHC01000913    JAV46732.1    AAGJ04115911    AAGJ04040339    KL367737    KFD59786.1    JYDO01000040    KRZ75306.1    JYDP01000296    KRZ01365.1    KRZ75294.1    GDIQ01002920    JAN91817.1    GDIQ01002921    JAN91816.1    AAGJ04043389    GGFJ01000432    MBW49573.1    JYDK01000180    KRX73317.1    GGFJ01000470    MBW49611.1    GGFJ01000471    MBW49612.1    GGFJ01000487    MBW49628.1    GDIP01030392    JAM73323.1    AAGJ04058558    JYDL01000102    KRX16693.1    AAGJ04001285    JYDI01000333    KRY45736.1    AAGJ04173907    AAGJ04141734    AAGJ04091218    GGMR01018506    MBY31125.1    JYDV01000070    KRZ36622.1    JYDW01000099    KRZ56190.1    HAEJ01004007    SBS44464.1    JYDM01000376    KRZ82090.1    JYDN01000258    KRX52286.1    AAGJ04132022    KL367527    KFD66131.1    GEHC01000872    JAV46773.1    AAGJ04118726    JYDU01000375    KRX86446.1    JYDP01000370    KRZ00917.1    AAGJ04152028    JYDN01000376    KRX51463.1    JYDT01000008    KRY92224.1    JYDS01000555    KRZ02797.1    NSIT01000285    PJE78034.1    KL367525    KFD66418.1    KL367558    KFD64244.1    JYDO01000345    KRZ65499.1    JYDM01000406    KRZ82010.1   
Pfam
PF05585   DUF1758        + More
PF17921   Integrase_H2C2
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF03564   DUF1759
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF00078   RVT_1
PF00628   PHD
PF14943   MRP-S26
PF00271   Helicase_C
PF00270   DEAD
PF17919   RT_RNaseH_2
PF03265   DNase_II
Interpro
IPR036397   RNaseH_sf        + More
IPR041588   Integrase_H2C2       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001995   Peptidase_A2_cat       
IPR001584   Integrase_cat-core       
IPR005312   DUF1759       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR019786   Zinc_finger_PHD-type_CS       
IPR000477   RT_dom       
IPR001841   Znf_RING       
IPR002999   Tudor       
IPR000253   FHA_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR027417   P-loop_NTPase       
IPR026140   MRPS26       
IPR013026   TPR-contain_dom       
IPR011545   DEAD/DEAH_box_helicase_dom       
IPR019734   TPR_repeat       
IPR001650   Helicase_C       
IPR011990   TPR-like_helical_dom_sf       
IPR014001   Helicase_ATP-bd       
IPR041577   RT_RNaseH_2       
IPR036875   Znf_CCHC_sf       
IPR004947   DNase_II       
IPR013087   Znf_C2H2_type       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       
SSF52540   SSF52540       
SSF48452   SSF48452       
SSF57756   SSF57756       

Ontologies

Topology

Length:
1888
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01338
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1888
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.074727
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号