SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00378
Annotation
PREDICTED:_uncharacterized_protein_LOC106713896?_partial_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.923 PlasmaMembrane   Reliability : 1.568
 

Sequence

CDS
ATGTTTTCTGTGTTTCAGACATTGTGCCCGACCGTGAATGTTTCGACACAACGACTGTCAGATCAGGTGAGGGCTATCCAGCGGCTTAGGCTGTTGGACCAGTCTCTTCTTGATCGACTACGCTACGAAGCGCTACCTGTTCCCATCGAACCACAAGAAAACCAAGTGGTAACTGACACCGTCGCCCCAATAATACAACACGATGAGGAAATTCAAGAACAGGTTTGTGCAAGTAACCAGGACTATGAGCGTTTGAGTAGTGCTTTGGAGGATTCTATTCAAGAATATAGGTTAGTCTCCGCCTGCTCTAGACCACGATTACCACGTTTGCCTATGCATAGACGTAATGTTTCGCTTGTAGGGGCCCTGGACTCTATTCTAAAACCCTATTTAGAATCAAGTACAGATCTAATTGATACGCACTCACTTCTATACTGCGGTGCGGTAGCGGTTTGTCGTGTAGCTGAGGTTAAGTCTCCAAACTTAACCCAGACAGCCTATCGACCCCCTACTAAACCACAATGGCAGTGCAGAATTGAGAAGCGAATTGATAGGGCCAGGATTCTTATAGCAAAGCTTATGTGCTTCCAGAAAGGAAATACTCGTCCACGGGTTATGTGTTTCGTCGATCAGGCCTTTGCCGGAACTGGAATAAGCTCAAACGAATACATGACCTGTATTATTGAGCGCATAGACTTCTGGAAGCAAAAAGTTTATGCTTGGGCAAGCCGTATTCGTCGGTATCGTCTAAGATCTGAGCGATACCATTTGAATAGAGTTTTCCAAAGAGATCAAAGAAGTGTATACAGAAACTGGGAGTCGTCTCAATCCCAAGTGACCGATGAGCCATACAATGTCAACGAAGAGGACATGTCAACATTTTGGAATAATATTTGGTCGATACCCATTGGTCACTCTGAAGGGGAATGGATACAAACTGTCAGGCGGGAATGTGAATCGTATAAAGAGATGGATTCAATAACAATTTCCGCCGTTGATGTTTCTCGTGCAGTACGTTCGATGCCAAATTGGAAAAGTCCGGGACCGGACGGACTGCACAGTTACTGGATCAAGTGGATCCGAAGTTCACATGAACGCCTGGCAGCTCAATTCCAACAGGCCCTTGAGTTGGGATCACTCCCAGATTTCATGACATCTGGTATCACTTATTTGATTTATAAATCTGGCAATACCTCGGATCCCAAGAATTACAGACCAATTACATGCTTACCTACTATCTATAAGCTACTTACATCCATTTTGAGAATCAAAATTCAAAATCACATTTTTAATAATAACATTTTATCACCTAATCAGAATGGATGTAAGGCAGGGTCTCGAGGTACAAAAGATTTGCTACTCATTGACATGACCATTACTCAACAAGTTCGGCGGAGTAAGAGGAACGTTCATATGGCTTGGATTGATTATAAGAAAGCGTATGACTCTGTGCCTCATACATGGCTAATGAGAGTTTTAGAGCTATATAAAATAAATCCCATACTATGCTCCTTTCTTAGCTCATGCATGGGTCAATGGTCTACGTTTCTTAGTCAACCAGGTCAGATGACTTCTTCTGCTGCCCCGAATTTAATAAGGATTAAGCGGGGTATCTTTCAGGGCGACAGTCTGAGTCCTTTGTGGTTTTGTTTGGCGCTTAATCCTTTAAGTACATTACTTAAAGATTCAACGCTAGGCTACCGACTTCGCAGAGGAGCTGAGGCTATATCACATCTCTTGTTCATGGATGATCTCAAATTATTTGCTTCCAAAAAACCAGACTTAATGAGTTTACTTAAAATAACCGACAATTTTAGTAAAGCCATTGGGATGGAATTTGGTGTTGATAAATGTGCGTTCATAGATGTACAGAGAGGTAAAGTTGTAAGCTCAGATTGCTTACTACTTAACCATAGTGTGGTCCTCAAGTCTCTTTGTGAATCGGAAACTTACAAGTACCTTGGTATGTTTGAAGTGCTGAATATTGTTGACGCAGATATGAAACAATCGTTTAGAGATCGGTTTTTTGGTCGTCTTATAAAGGTCTTAAAAAGCCATTTATCAGGCGGAAACAAAATCCGAGCGTTTAATGGTTGGGTCATGCCTATGTTAACATATTCCTTTGGCATACTAAGGTGGACGCAATCAGAGCTGGACGTACTGGACAGAAAAGTCAGACGATTGTTAACGGCATACAGAATGCATCATCCACGTTCGTCTGTAATGAGGTTGTATATTCCTCGGAAATGTGGGGGTCGTGGTATTTTGAATGCCAAGGATCTACATAACCGAGAGATATACAACCTTAGGGAATATTTCCTTAAGATGAACGTGAATATGTATCGGGATGTCGTTGCAGTCGATAAGGGGCTAACTCCGCTATCCTTAGCTAACGGGAATTGGAAGAGGCTGAAGGTAGAGAGTATTTCAGATCGCATAACTGTATGGAGGAGCAAGGAGTTACACGGTAGGTTCTACCGGGCTCTCACAGGGCCTGATGTAGACCAATTAGCTTCCGTAGCCTGGTTACGATTCAGTAACCTCTTTGGGGAAACTGAAGGTTTTATCTTTGCAATTATGGACGAAGTTATCATGACGAACAACTACCGGAAATATATACTAAAGGATGGGACGGTCGACATTTGTCGGGCATGCCACCGTCCGGGAGAGTCTATTAGACATATTGTTTCTGGCTGTTCTCGGTTTGCTAACGGCGAGTACTTGCATAGACATAACCAAGTGGCTAGGATTATCCATCAACAACTTGCTCTGAAATATGGTTATCTTGATTCTGCTGTACCTTATTACCAATACCAACCTCAACCAGTTCTTGATAATGGTCATGTTACGCTCTACTGGGACCGATCTATTATCACGGATAGGTATATTGTTGCCAATAAACCTGATATTGTGATAATAGATCGATCTGCGCGTCGAGCAGTGTTGGTTGATGTCACCATTCCTCATGACGAGAACCTCGTGAAGGCAGAAAAGGACAAATTAATAAAATATTTAGACCTGGCCCACGAGACTACCGCCATGTGGCATGTTGATTCAACCATCATTGTTCCAATAGTTGTATCGGTACACGGCTTGATAGCGAAAAGTTTCGATCAACATCTTAAGAAACTTTCGTTATCCAGCTGGGTTAAGGGCCTAATACAGAAAGCAGTTATCCTTGATACTGCACGCATTGTGAGGAGGTTTCTCAATCTGGAGTCCTAA
Protein
MFSVFQTLCPTVNVSTQRLSDQVRAIQRLRLLDQSLLDRLRYEALPVPIEPQENQVVTDTVAPIIQHDEEIQEQVCASNQDYERLSSALEDSIQEYRLVSACSRPRLPRLPMHRRNVSLVGALDSILKPYLESSTDLIDTHSLLYCGAVAVCRVAEVKSPNLTQTAYRPPTKPQWQCRIEKRIDRARILIAKLMCFQKGNTRPRVMCFVDQAFAGTGISSNEYMTCIIERIDFWKQKVYAWASRIRRYRLRSERYHLNRVFQRDQRSVYRNWESSQSQVTDEPYNVNEEDMSTFWNNIWSIPIGHSEGEWIQTVRRECESYKEMDSITISAVDVSRAVRSMPNWKSPGPDGLHSYWIKWIRSSHERLAAQFQQALELGSLPDFMTSGITYLIYKSGNTSDPKNYRPITCLPTIYKLLTSILRIKIQNHIFNNNILSPNQNGCKAGSRGTKDLLLIDMTITQQVRRSKRNVHMAWIDYKKAYDSVPHTWLMRVLELYKINPILCSFLSSCMGQWSTFLSQPGQMTSSAAPNLIRIKRGIFQGDSLSPLWFCLALNPLSTLLKDSTLGYRLRRGAEAISHLLFMDDLKLFASKKPDLMSLLKITDNFSKAIGMEFGVDKCAFIDVQRGKVVSSDCLLLNHSVVLKSLCESETYKYLGMFEVLNIVDADMKQSFRDRFFGRLIKVLKSHLSGGNKIRAFNGWVMPMLTYSFGILRWTQSELDVLDRKVRRLLTAYRMHHPRSSVMRLYIPRKCGGRGILNAKDLHNREIYNLREYFLKMNVNMYRDVVAVDKGLTPLSLANGNWKRLKVESISDRITVWRSKELHGRFYRALTGPDVDQLASVAWLRFSNLFGETEGFIFAIMDEVIMTNNYRKYILKDGTVDICRACHRPGESIRHIVSGCSRFANGEYLHRHNQVARIIHQQLALKYGYLDSAVPYYQYQPQPVLDNGHVTLYWDRSIITDRYIVANKPDIVIIDRSARRAVLVDVTIPHDENLVKAEKDKLIKYLDLAHETTAMWHVDSTIIVPIVVSVHGLIAKSFDQHLKKLSLSSWVKGLIQKAVILDTARIVRRFLNLES

Summary

Pfam
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR001611   Leu-rich_rpt       

Ontologies

Topology

Length:
1074
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.04234
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  1074
 
 

Population Genetic Test Statistics

Pi
1.357489
Theta
2.250926
Tajima's D
-1.898309
CLR
0
CSRT
0.0133993300334983
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号