SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00367  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA000515
Annotation
THAP_domain-containing_protein_9?_partial_[Camponotus_floridanus]
Location in the cell
Cytoplasmic   Reliability : 2.49
 

Sequence

CDS
ATGAACAAATTATACATCGGTAATTTGCCGTATGAAGTTGACGAGGCAGCTGTACGACAATTGTTTGCTGAACAAAATTTGACTGTTGCTGAAATTTCGGTGAAACGAGGTGGCTACGCATTCGTGGATTTCCCTGACCAATCTGCAGCCGATCGAGCCATCGATAAACTACACGGGTACTCATTTTGCGGGCTCCCATTGATCGTTGAACCTTCAGTGGCAAACAAGAAAATGGTTAATGTACCCAACCTTGAGAGATCGAGTGCCGCCCAGCTCAACGAAGGCAGCAACGGCTCGCCATCAGGAGGATGGAGTGCTGATCACGTTACGCAATTAGAAAACATTGGAGTAACCGACCTTATCCAGCGTTATGAAAGAAATGTTTCATCGGGTCAAAGTACTAACCAGAAATATCCGCCTGCTTTAAGAATTTTTGCCACTACTCTTCACTTTTATTCGCCAAAGGCGTACGCGTATGTAAGAAAAAAATTCCAAACAGCTTTGCCTCATATTCGAACCATAAAAAAGTGGTACCAATCTATCGATGCTCAGCCTGGATTCACGCAAGAATCATTAAAAGCGATAAAACTTAAAACTGCCTGCACTAAACACAAATTGTTGTGTAATTTAGTTTTAGATGAAATGGCAATCAGACAGCATGTAGAGTGGGATGGAAAACAAATGCACGGGTATGTTGATATTTCTAATTCTGCAGAACAAGGGGATTGTTTACCCGAAGCCAAAGAAGTTCTTGTATTTTTAGTTACCGCAATTAATGGGGCTTGGAAAATACCAGTCGGGTATTTTCTCATTGACGGTGTCACAGGAGAACAACGGTCTAATCTTGTCAGACAATGTTTGGAATTATTAGAAGATACAGGTATTCAAGTTACCTCGATGACTTTTGACGGCTGTCCAGCCAATATCACCATGGCTAAGAAACTCGGATGTTCTTTTGAAGTTGAAAACTTAAAATCATATTTTGAGCACCCCGTTACTCGTCAACCTGTACATATTTTTCTCGATCCATGCCACATGCTGAAGCTATTGAGAAATGCTTTTGAATCATATGGATGTTTCATGGATGCTTCAAATAGGTGTATAAAATGGAGTCATCTAAAAAATCTGTATGACATTCAGGATAAAGAAAAACTGCACTTAGCAAATAAATTACGAAAAAGTCATATCTTTTTCAAGAACCAAAAAATGAAAGTTCGCTTAGCTTCGCAATTATTTAGCAACAGTGTTGCAGATGCCCTGAATTTTTGTTGTGAACTTCAAATCGCTGGTTTTGATGATGTAGAAGGCACTGTGGAATATCTAAAAACTATCAACAACTTGTTCGATGTGTTAAATTCAAGGCATATGGCCCAACTCCATTATAAAAAACCAGTTTGCCCAGGCAACAAAGACAAGGTATTTGAAACTTTAGAAAAGGCGAAACGGTGTCTAACATCTATAAAGCTTTCAGATGGTACAAAAGCTATCATTACACCCAGAAAAACCGGTTTTATTGGTTTATTAGTGTGCATAGAAAGCCTCAAGGCCTTGTATATACAACTAATTGAAAAGGACCAAAAACTTAAGTACATTCCGGCTTACAAAATCAGCCAAGATCATTTAGAGCTTATGTTTGGACATATACGGTCACATGGTGGATGCAGCACCAACCCAACGGCGCGACAGTTTCAAGCAATATATAAAAAGCTCTTGGTAAAGTCGGAGCTTAGAGATGTAGACCAGGGAAACTGTATAGCTCTTGAGGAGGTTTCTTTTTTGTCGTGCTCTTCAGCTGTCCAAAATATAAATCTGACAATCGAACCATGTAAGTTACACGAAGGTAATGACGAAGACGAGATGAGTTTATTATATGAACAAGCCGTATTTGATGAGGAAATCAGTATACTTGTACAAGATGTCACAGAATTTAGTAGCCAGGTATGA
Protein
MNKLYIGNLPYEVDEAAVRQLFAEQNLTVAEISVKRGGYAFVDFPDQSAADRAIDKLHGYSFCGLPLIVEPSVANKKMVNVPNLERSSAAQLNEGSNGSPSGGWSADHVTQLENIGVTDLIQRYERNVSSGQSTNQKYPPALRIFATTLHFYSPKAYAYVRKKFQTALPHIRTIKKWYQSIDAQPGFTQESLKAIKLKTACTKHKLLCNLVLDEMAIRQHVEWDGKQMHGYVDISNSAEQGDCLPEAKEVLVFLVTAINGAWKIPVGYFLIDGVTGEQRSNLVRQCLELLEDTGIQVTSMTFDGCPANITMAKKLGCSFEVENLKSYFEHPVTRQPVHIFLDPCHMLKLLRNAFESYGCFMDASNRCIKWSHLKNLYDIQDKEKLHLANKLRKSHIFFKNQKMKVRLASQLFSNSVADALNFCCELQIAGFDDVEGTVEYLKTINNLFDVLNSRHMAQLHYKKPVCPGNKDKVFETLEKAKRCLTSIKLSDGTKAIITPRKTGFIGLLVCIESLKALYIQLIEKDQKLKYIPAYKISQDHLELMFGHIRSHGGCSTNPTARQFQAIYKKLLVKSELRDVDQGNCIALEEVSFLSCSSAVQNINLTIEPCKLHEGNDEDEMSLLYEQAVFDEEISILVQDVTEFSSQV

Summary

EMBL
ODYU01003321    SOQ41917.1    GEZM01099613    GEZM01099610    GEZM01099604    GEZM01099599    + More
JAV53268.1    GEZM01099608    GEZM01099605    JAV53264.1    GEZM01099609    JAV53257.1    GL441823    EFN64217.1    GEZM01077470    JAV63295.1    ABLF02011460    ABLF02033413    ABLF02012848    ABLF02012849    ABLF02012851    ABLF02007004    ABLF02007005    ABLF02008523    KQ977365    KYN03296.1    KQ977321    KYN03587.1    NWSH01000621    PCG75234.1    GEZM01031190    GEZM01031189    GEZM01031180    JAV84979.1    GEZM01031195    GEZM01031187    GEZM01031186    GEZM01031184    GEZM01031182    GEZM01031181    JAV84992.1    GGMR01004395    MBY17014.1    KQ982672    KYQ52446.1    GGMR01018395    MBY31014.1    ABLF02038040    ABLF02065516    ABLF02016100    GGMR01014547    MBY27166.1    NWSH01001223    PCG72048.1    ABLF02011489    ABLF02009662    ABLF02016193    GCES01153042    JAQ33280.1    ABLF02016252    GFAC01001507    JAT97681.1    ABLF02003302    KQ979651    KYN20001.1    HAAD01001124    CDG67356.1    ABLF02009087    HADY01024360    SBP62845.1    HADZ01019172    SBP83113.1    HAEJ01000494    SBS40951.1    AERX01031390    ABLF02033156    GGMR01015195    MBY27814.1    ABLF02015114    ABLF02003891    ABLF02003892    ABLF02003893    ABLF02003894    ABLF02014815    ABLF02014817    ABLF02066539    GEZM01060283    JAV71121.1    ABLF02013367    ABLF02015440    ABLF02057211    ABLF02032544    ABLF02032554    KQ981062    KQ980795    KYN09968.1    KYN13021.1    KQ977081    KYN05929.1    ABLF02042324    ABLF02062307    ABLF02067566    ABLF02056709    ABLF02067302    GL437635    EFN70236.1    ABLF02015299    ABLF02005485    ABLF02008676    ABLF02008677    HAEA01002407    SBQ30887.1    ABLF02019247    ABLF02019254    ABLF02003109    ABLF02024163    ABLF02065890    ABLF02066605    GEZM01007799    JAV94911.1    KQ976993    KYN06573.1    KQ980298    KQ978748    KYN13019.1    KYN16830.1    KYN28629.1    GEZM01007800    JAV94909.1    ABLF02010172    AJVK01060859    KQ977417    KYN02849.1    GEZM01073324    JAV65152.1    GEZM01073325    JAV65151.1    GEZM01095994    JAV55218.1    ABLF02031636    ABLF02031641    ABLF02031645    ABLF02031655    ABLF02046386    ABLF02048949    AJVK01061645    KQ982514    KYQ55617.1    ABLF02005824    ABLF02005825    ABLF02005826    ABLF02005827    ABLF02050516    ABLF02053731    ABLF02041912    KQ979155    KYN22412.1   
Pfam
PF12017   Tnp_P_element        + More
PF05485   THAP
PF14291   DUF4371
PF00076   RRM_1
Interpro
IPR006612   THAP_Znf        + More
IPR021896   Transposase_37       
IPR038441   THAP_Znf_sf       
IPR012337   RNaseH-like_sf       
IPR025398   DUF4371       
IPR001315   CARD       
IPR034772   CPSF6/7       
IPR000504   RRM_dom       
IPR012677   Nucleotide-bd_a/b_plait_sf       
IPR034771   CG7185-like       
IPR035979   RBD_domain_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF54928   SSF54928       
Gene 3D
PDB
2CQH     E-value=2.09063e-09,     Score=151

Ontologies

Topology

Length:
647
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.15831
Exp number, first 60 AAs:
0.00085
Total prob of N-in:
0.00188
outside
1  -  647
 
 

Population Genetic Test Statistics

Pi
20.931331
Theta
17.57997
Tajima's D
0.822456
CLR
0
CSRT
0.618119094045298
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
25044914 RGGVTVTIAGIEGSSPVICSR 100.00 1e-06
25044914 GGWGISPR 100.00 9e-06
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号