SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00357
Annotation
PREDICTED:_nascent_polypeptide-associated_complex_subunit_alpha?_muscle-specific_form-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.69
 

Sequence

CDS
ATGTCTGGGGGGACATCACCCCCCATTATCAGCACCCCCGGCCCGTCCCGTAAGGGACGCCAAGTTATGTCGAGTCTAAGATTCAGACCAGCACCAGCAACCCGTACAGTCTCGATGGGACTCGGGACGGACAGCCGGCCCGGGCCTCCGGTCGCGGCCCAAAGGACTCCGAGGATCGAACCGGAGGAAGATGTCCTTCCCCCGTTGACCGATCCCTCTGGGCCCTCTCGGCCGCGGAAGAAGGCCAGGTCCGAGTCTGACCGAGGCTCATCGAGCGAAAAGGACAAGCGTCCTAGAATAGGCCCCTCATCTAGATCGGAGGGAGAGGAAAGTGCGACCACATCCTCTGCACACTCCTCAACCGAATCGGTCACTCCTTCCTCGTCTAGGTCTTCGTCCCCCTCTGGGAGTCCAATCCCAGTTCAACCAATTCCGAAGCCTAGGGCTCCCGCCAGGACAGGGACAGCCCCAAGGCAAGTAAGATCCCCTCCTCGCTCTCCTTCCCCAACGCTATCTCCAATCCCGGTAGACTCAACCCGAGGTGCCCCCGCCCTAAGCGGCACGGCGGGCAACCTGGATTCGACCAGGTACATGGACCTCGAGTCTACCAGACCTCAACAAGCCACTAAGCCCAACCCCACTCCCTCCACCTCCTATGCTGCCATGGCAGCTAGGCCAGGTATCCCTACCGCCCAGAGGACTTCCCAATCCTCACGAGTCCCTCCCCCGAGGCCGAAGGGTCGCGCCCAGGAGGAACTGCGCCGACACCCGCCAATTATGGTGGAGGCCCTCCCAAATTGGTCCCGCCACATGGCGGCCATTAGGGAGCGCCTAGGCCGCGCCCCCTCGGTGCGACCCTTCGGCGCCGGTTTCAGATTTCTGCCGACGTCGGCTGAGGAATATAGGGCGGTCCAGGCCTACCTGTCGGAGGCCTCTGCCAGGGACGGTACCATTAAATGGTACTGTTACGCCCTGGCGGAGGAGATGCCTTCGAAGGTGGCGGTCCGGGGCCTCCCTGCCGACACCGACGAGGCAGAAATAGTCAATGCCCTGAAGGAGCTGGGATTCCCGGCTCGATACGCCAGGTGCATTAGGTCCCGGAGAGGGCGTCCGGGCTGCGTTTTTCACGTAGCCCTGGACCACCTCTCGAAGGACGACCTCGCCCGCTTGTACGCAGTCAACGAACTGCTGTACCTGCCGGGGGTGACGGTCGAAGGATGGCGTCCAATCCGAGGGCCTGCGCAGTGTCATCGCTGCCAGGCCTTCGGACACGCCTCCTACAACTGTCATCGCGCGGTCCGTTGCGTAAGGTGTGCCGGGGAGCACATCGTAGCGGACTGCCCGAGGCCGAGGGACGGCCCGTTCTCCTGTGCCAACTGCGGGAAGGACCACGCCGCCGTCGACAGACGGTGTGCGGTCTTCCGCAAACGGGCCAGGATGATGGGAGCAACCGTCCCCCCTCCTGCACCACAGGCACCTCGAGCCGGGAGTGCAGCTCTTCCGGCTTCAATACCTGTAGCAAAGGGGAAGGGGAAGGGGAAAGGGAAAACTTCCCAGCCCCCTCCCCCATCCCACTCCGCTCCGTCTGCTGTGGTGGTGGAGGCACTGCCATCGGCGCCTACGCTGATGGCACAGGCCAACCCACCACGGCGGATAAATAAACCCAAACCCACTCCTGCTCCCCGTGGTCGTACATCTGCTGGTATATCAGTGCCTAAACCACTCCCGACTAGCGGCCCTACGTCCACTAAAAGGGAGAAGAACAAGAGGAAAAAGGCCAAAAGGAAAACAAGAAAAAGGGAAGAAAGAGAGAGACTAAGGGGTACATCTGAACCCACAGTGCCAGAACCCCAACAAACCAACACAGAAACCATGGAGGTCTCCGAGGCCCCCCTTACTGCCCAACAACCGACATCAAGCCAACCACTGCCTACAGCCCATCCGGCCGAAGGCAAGCACGACTTGAACAACCAGCCCCCCCTCCCCCCCCGCCCTCAGCGCGAGCGCCGCAGCGGTCGACAGGCCTCCCAGCCTGCCGGCTTTGCTGCATGGCTGCTCGCACTGTGGGAGAAATTGTCCGAGGTGATCTCCGGAGTAATCCGTGAGATCGCCTCGGGAGCCAGTCCCTTCGGGGCGCTCCTGTCGGGGTTCTACCGAATGATTGCGCAGTTCAATGGCTAG
Protein
MSGGTSPPIISTPGPSRKGRQVMSSLRFRPAPATRTVSMGLGTDSRPGPPVAAQRTPRIEPEEDVLPPLTDPSGPSRPRKKARSESDRGSSSEKDKRPRIGPSSRSEGEESATTSSAHSSTESVTPSSSRSSSPSGSPIPVQPIPKPRAPARTGTAPRQVRSPPRSPSPTLSPIPVDSTRGAPALSGTAGNLDSTRYMDLESTRPQQATKPNPTPSTSYAAMAARPGIPTAQRTSQSSRVPPPRPKGRAQEELRRHPPIMVEALPNWSRHMAAIRERLGRAPSVRPFGAGFRFLPTSAEEYRAVQAYLSEASARDGTIKWYCYALAEEMPSKVAVRGLPADTDEAEIVNALKELGFPARYARCIRSRRGRPGCVFHVALDHLSKDDLARLYAVNELLYLPGVTVEGWRPIRGPAQCHRCQAFGHASYNCHRAVRCVRCAGEHIVADCPRPRDGPFSCANCGKDHAAVDRRCAVFRKRARMMGATVPPPAPQAPRAGSAALPASIPVAKGKGKGKGKTSQPPPPSHSAPSAVVVEALPSAPTLMAQANPPRRINKPKPTPAPRGRTSAGISVPKPLPTSGPTSTKREKNKRKKAKRKTRKREERERLRGTSEPTVPEPQQTNTETMEVSEAPLTAQQPTSSQPLPTAHPAEGKHDLNNQPPLPPRPQRERRSGRQASQPAGFAAWLLALWEKLSEVISGVIREIASGASPFGALLSGFYRMIAQFNG

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
726
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.33584
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  726
 
 

Population Genetic Test Statistics

Pi
29.550066
Theta
38.354219
Tajima's D
-0.644455
CLR
0.007616
CSRT
0.209839508024599
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号