SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00355
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_3-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 4.094
 

Sequence

CDS
ATGGATAGACTACGAAAAAAGAACTATGAAAAAGTAACAAAAGACAAAGTAAGTAACAAAAGGCAAATGAGACCGTTGGACAGCGATTTAATATTACATCTGCTTCAAGACGGAAACGATTCTGAAGTAGAAGGTATCGATGATGATGACGAATTGCCTCTCCAAAGGCCTTGTAACCCTGCTGTCATTGATGTTCCATCACCACAATTTCCAATACCGCCCCCAGCTCAACCTCAACGTAGAAATGTGGTTCAAAACAAAGCAAAAGCCAGAAGAAGACTTTGGAGACAGGAGGCTTTTAGTCAAAAAGAACATGGCTACCCACAACGCGTTCAGCCGGGTGTTATCAGAGAACCCTTAGAATATTTTAGCGACTATTTTAATGATGATTTTTTTGAGTCAACTGCGTTTTGTACCAACAATTATTTCATGCGCCACAATGGCCGTATCTTAAACACAAATGCCATTGAATTAAAGAAACTGGTAGGCATACATTTCATCATGGGATGTATCCCATACCCGCGGTTGTTCATGTACTGGCGAGAAGGATTACGATTGGATATAGTCGCGAACGTCATGGCCAGAGACAGGTTCAAGACTCTGCGTTCAGCATTGCACGTCGTTGACAGTGACACTGCTCCGACAGGAAATACCAACACACTGTGGAAAGTACAACCAATACTTGACCGGGTTAAAAAAACATGTGATCGACTCGAAAGACAGCCGGGATATTTTTCCATAGATGAACAAATGATCCCTTTTAGTGGTGTATGTCCACGTGGGCTGCGACAGGTTATCAAAACCAAGCCTCGACCCCAAGGTTTAAAAGTTTTTGTGGCCACCACACATGATGGACTAATGATTGACTTTGAAGTTTATAGAGGTGCCAACACTTCAATGGGTGACAGATCTTTGGGAGTTGGAGCGTCGATAATTTTACATCTTTCTAAGTCAATTCCAAGAGGCAGCTGCATTTATTTTGACCGGTACTTCTCGTCAATACCTTTGCTTGAAAAGCTAAGCACTATTGGGCTACACGGTACAGCAACGCTAATGATGAATCGAATACCTGAACGGAAAAACATCGATTTCAAACCTGATCGCCGTATGAAACGTGGTGAATCGCAACAGTTCGTGTGTGACGATGTCGTAGTTGTTAAATGGATGGATAACAAATCCGTGCTAGTTGCATCAAACTGCACATCTGCTGACGATACAACATTTGTACAGCGTTGGGATAAAAATATCTCTGCTTTCACTGATGTTACCGCGCCCAAAATAATCGCTAATTACAATAGGTACATGGGTGGTGTGGACATCCTTGATCAATCAATGGAGTACTACCGCACCTTTATGAAGACGAGAAAATGGACGTTAAAGGTCATACTCCATTTCTTTGATCTGGCTCTTTGTAATGCATGGCGCTTGTATAAATTGGAATGTGCAGCAGCTGCGATCCCAAATAGCAAAGTTATGGACTTGTTAGAGTTTCGGATGCAAGTAGCAGATGGGCTTACCAACACGCCTAATCGCCGAAGGAGGATTAGCGAGAGTGATGAAAATGCTGTCGAAAATGTAGTGCAAAATAATAATACAAGGTTTAAGAGAACAAATCAGCCCTCTCAAGCCAAAAAGTACGACGGCTACGACCACCTTCCATGTTTTGAAAGCATTGATAATCCTCGCGCATGCAGAATGGAAAATTGTAAAAGCAGGTCAAAGATTCGGTGTGTAAAGTGTGATGTGTATCTCTGCCTCAAAAGAGGACAAAACTGCTTTGCAGCATATCATACAAAATAA
Protein
MDRLRKKNYEKVTKDKVSNKRQMRPLDSDLILHLLQDGNDSEVEGIDDDDELPLQRPCNPAVIDVPSPQFPIPPPAQPQRRNVVQNKAKARRRLWRQEAFSQKEHGYPQRVQPGVIREPLEYFSDYFNDDFFESTAFCTNNYFMRHNGRILNTNAIELKKLVGIHFIMGCIPYPRLFMYWREGLRLDIVANVMARDRFKTLRSALHVVDSDTAPTGNTNTLWKVQPILDRVKKTCDRLERQPGYFSIDEQMIPFSGVCPRGLRQVIKTKPRPQGLKVFVATTHDGLMIDFEVYRGANTSMGDRSLGVGASIILHLSKSIPRGSCIYFDRYFSSIPLLEKLSTIGLHGTATLMMNRIPERKNIDFKPDRRMKRGESQQFVCDDVVVVKWMDNKSVLVASNCTSADDTTFVQRWDKNISAFTDVTAPKIIANYNRYMGGVDILDQSMEYYRTFMKTRKWTLKVILHFFDLALCNAWRLYKLECAAAAIPNSKVMDLLEFRMQVADGLTNTPNRRRRISESDENAVENVVQNNNTRFKRTNQPSQAKKYDGYDHLPCFESIDNPRACRMENCKSRSKIRCVKCDVYLCLKRGQNCFAAYHTK

Summary

Pfam
PF13843   DDE_Tnp_1_7        + More
PF05485   THAP
PF18701   DUF5641
Interpro
IPR029526   PGBD        + More
IPR006612   THAP_Znf       
IPR038441   THAP_Znf_sf       
IPR040676   DUF5641       
IPR013087   Znf_C2H2_type       
Gene 3D

Ontologies

Topology

Length:
599
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
4.20656999999998
Exp number, first 60 AAs:
0
Total prob of N-in:
0.21819
outside
1  -  599
 
 

Population Genetic Test Statistics

Pi
31.52759
Theta
29.389833
Tajima's D
0.019648
CLR
0.004118
CSRT
0.379231038448078
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号