SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00323
Pre Gene Modal
BGIBMGA000692
Annotation
PREDICTED:_dynein_heavy_chain_6?_axonemal_[Bombyx_mori]
Full name
Dynein heavy chain 6, axonemal       + More
Dynein heavy chain 1, axonemal      
Dynein heavy chain 7, axonemal      
Dynein heavy chain 2, axonemal      
Dynein heavy chain 3, axonemal      
Dynein-1-beta heavy chain, flagellar inner arm I1 complex      
Dynein heavy chain 10, axonemal      
Dynein beta chain, ciliary      
Dynein heavy chain 9, axonemal      
Dynein-1-alpha heavy chain, flagellar inner arm I1 complex      
Dynein heavy chain 17, axonemal      
Dynein heavy chain 11, axonemal      
Dynein beta chain, flagellar outer arm      
Dynein heavy chain 8, axonemal      
Dynein heavy chain 5, axonemal      
Dynein gamma chain, flagellar outer arm      
Dynein alpha chain, flagellar outer arm      
Dynein heavy chain, cytoplasmic      
Dynein heavy chain 12, axonemal      
Cytoplasmic dynein 2 heavy chain 1      
Cytoplasmic dynein 1 heavy chain 1      
Dynein heavy chain-like protein PF11_0240      
Dynein heavy chain-like protein MAL7P1.162      
Dynein heavy chain domain-containing protein 1      
Alternative Name
Axonemal beta dynein heavy chain 6
Ciliary dynein heavy chain 6
Axonemal beta dynein heavy chain 1
Ciliary dynein heavy chain 1
Heat shock regulated protein 1
hDHC7
mDHC7
Axonemal beta dynein heavy chain 7
Ciliary dynein heavy chain 7
Dynein heavy chain-like protein 2
hDHC2
Axonemal dynein heavy chain b
Dynein-like protein 7
Axonemal beta dynein heavy chain 2
Ciliary dynein heavy chain 2
Axonemal beta dynein heavy chain 3
Ciliary dynein heavy chain 3
Dnahc3-b
Dynein heavy chain domain-containing protein 3
1-beta DHC
Dynein-1, subspecies f
Axonemal beta dynein heavy chain 10
Ciliary dynein heavy chain 10
Axonemal beta dynein heavy chain 9
Ciliary dynein heavy chain 9
1-alpha DHC
Axonemal beta dynein heavy chain 17
Axonemal dynein heavy chain-like protein 1
Ciliary dynein heavy chain 17
Ciliary dynein heavy chain-like protein 1
Dynein light chain 2, axonemal
Axonemal beta dynein heavy chain 11
Ciliary dynein heavy chain 11
Axonemal beta dynein heavy chain 8
Ciliary dynein heavy chain 8
Axonemal beta dynein heavy chain 5
Ciliary dynein heavy chain 5
DHC alpha
Dynein heavy chain, cytosolic
Ropy-1
Bm259
Axonemal beta dynein heavy chain 12
Axonemal dynein heavy chain 12-like protein
Axonemal dynein heavy chain 7-like protein
Ciliary dynein heavy chain 12
Dynein heavy chain 7-like, axonemal
Dynein heavy chain domain-containing protein 2
Cytoplasmic dynein 2 heavy chain
Dynein cytoplasmic heavy chain 2
Dynein heavy chain 11
Dynein heavy chain isotype 1B
Dynein-like protein 4
Abnormal chemotaxis protein 3
Cytoplasmic dynein heavy chain 1
MAP 1C
DHC08
Cytoplasmic dynein heavy chain 1b
Dynein heavy chain domain 1-like protein
Protein CCDC35
Location in the cell
Cytoplasmic   Reliability : 2.556
 

Sequence

CDS
ATGCTAGCGGATATGCTACGTATACACGTTAATTTCACACCGAGTCGCGAGCTATTGGAAGGCTCTGCACTAGATGAAGTTCTTGAAGTACTACCAAGGCAAACTGATACTTGCAAATGGGCTCTGTTCCAAGTGGACGCCTACGTCAGACCGAATGGTGCGGTAGAGCTAAATCCAAGTCAAGAAATTATTTCTTCGTATTTAGAGAAGATTACGAGTTATTGGGATGAGCACGTGCGAAAATTCCGACAATTCTTAACCGAAGAAACATTACAAATGATTGTCCAACCGACGATAATGGGTAAACAGGTCGAGTGGTCTGCTGGCATGTCGCCCAATTTGTATTTTCTAATGAACCAGGACAAGAAGATGTTAGACGACATAACCTTCATTCCAACTTCTATTAAAAATGCATACGAGTGCGTCTGGCTGTTCTTAAACAGAATGCAAGCATTTATGGACAGCTTTAAGGAAGCTCACGAAATGGATGTGAATATTATTAAACAAGAAAGGGATTTGAATGAGTTTAGAAAGCTTTGTGAAAAATTTGTTAAGCAAATGGAAGCTATCGAAGACGTGGTTAGCTACCAACCGTTAGGTTTAATATTTCTATGCTTGAGCCCTTTCCAGGAGCTATTTAGGCCGCAACCCAAGAGATTGTTTGACGTTGTACTCAACGTTACTCCCGATATCGGTCGTGAATGCATTGATGGAATATTGGAAGGAGTTGAGAATATAAGTGGAGATATCACTAAAGATCCTGAAACAGCGAGCGAACTAGTAGCTTTTAATTTCATGTTAGACGGATTAGAATCTCGCGTTGCATTCCTCGAAGAAAGACTGGAATACTTGAGGGAGCTTTACGATCTGATGGGAGAGTTCAATATACCTATTCCACCTGAAGATATGACCCAGTTCTTAGGTCTGAGCGTTACACTCAGTACTCTACGGAGCGATGTCGATGCTAGAATAGAATCGCGTAGCAAACTCGCCGGTATGTTTGCAAGTCAAATTGGCAAAGACATTATGAATTTAATGTTAGATGTTAATAAACTAAGGGATGAAGTTACGCAACCGTGGTTATATGACGAGAAATCGGATCTAGAGAAAGTTATGGAGACACTCGACGATCTATTGGAAAAATTAATGGCATGTTCGGCTCGAGACAAGCAAATCCGGGAATGGCAAAAAATATTCAAGATACCGCCAGCTAGGTTAGAGCAATTAGACGAAGCCATAAATGACGTCAAACTTAGACAGCTTCTTTGGAAAGCATCTAAAGAATGGAACGACATGTTCAAATCTTGGTACGATAATCCTTTTAATACCTTGGACGTAGACGAGATACAAAACACGACAATAAGCTACGGCAAAATATTTAATCAACTGGACAAAGGTTTACCTAGTAATACAATCGTACCGAAATGTAAAGAACTCATCGACGTTATTAAGGAGAAATTACCGGTGATTTCGTATTTACGCAATCCGGCTTTAAAACCACGACACTGGGTGAAAATAGAAGAGATTTTGCACACCCGATTCACGCCTGACGTCGTAATGAATCTGCAAATGTTCGAAGAGCTCCAGGCTTTCCAACATTCTGATGAACTCATGGAAGTTGCCGGTCAAGCTAGTTCGGAAGCTGGTCTCGAGTCTCTATTGAAAAAAGTTGAAGAGATATGGGCCGCTTTGGAGTTTCCCGTTATTTTACATAAAGACGCCAGAGATGTGTATGTCCTCGGTGGCTTAGATGAAATACAAGCGAGTCTTGACGAGAGTAACATTCACATAAGCACAATATTGAGTTCGAGAAACTGTGGTCCGATTAAAAGCCGAGTCGAAGAATGGGCAAAGAATTTGGAGCTTTTCGCTAAGACTTTGGAAGAATGGTATGCATGTCAGCAGACGTGGATGTATTTGGAGGTTATATTCTCGGCGCCTGACATTCAAAGACAGTTGCCAAATGAGACGAGGCTCTTTTCGATTGTCGACAAATCCTGGAAGGATATTATGCGTAAACTTGCTAAGGTTCCATTGGCGATGCCAGCGGCAACGCAACCAAAACTTTACGAGGAGTTCGTACGGAATAATGAAATGTTGGATCAGATAATGAAATGTCTCGAAGCATATTTGGAAACTAAACGTGTGGCTTTCCCTAGATTTTTCTTCTTATCCAATGACGAGCTATTAGAAATTTTAGCACAGACTCGCAATCCGCACGCGGTGCAACCTCACCTCCGAAAATGCTTTGACGCTATAGCCAAATTAGAATTCGGTGTAAAGTTTCCGGAAAGTGAAATGGAGATAGCGGAAGACGGAACTTTAGTCGAAAAGGAAATGTCGTTTCAAACGAGGGACATGCTGCAAGCTAAATTAGCAAAAACTGCGAGCCCTGAAGATTTGACTACAGATATTGTTGCTATGCTATCTCCGGAAGGGGAGAGGGTTAACTTGGGAAAGGGTCTAAAAGCTCGAGGTAATGTTGAAGATTGGTTGGGAAAAGTCGAGGAAGCAATGTTTGCATCAGTGAAACGATGCATGAAATTTGCATTAAAAGAATACATGGTGAATGAACGAGTGGATTGGGTCGAAATGCATCCTAATCAGGTAGTCCTAACCGTCTCACAGATAATGTGGGCCAAAGGAGTCCACGAGGTATTTAATTTGGAGATACCTCTCCGTATCGATACGGGGTTACTGAGCTACGAGAAAAAATGTATATCGGACCTCAATGACTTGGCTGCTTTGACGCGAAAAGATCTGACCTTATTATTTCGAAAGGTTTTGTGTGCTTTGATCACGATCGATGTACATGCAAGGGATACTATATCACATATGGTCGAGAAACACGTTCAAAAAGCAAACGATTTCGAATGGTTAAAAATGATTCGTTATTATTGGGAAGAAGATATCGATAATTGTGTCGCAAGAATGTCTAGTGCCATGTATATATATGGACACGAGTATCTAGGAGCTGGAGGTGTCTTGGTTATAACGCCATTGACGGACCGCTGCTACCTTTGTCTGATGGGAGCTCTCCAGCTTGACCTTGGAGGGGCTCCGGCTGGACCGGCTGGAACCGGAAAGACCGAGACAACTAAAGACTTAGCTAAATCCCTCGCCATACAATGCGTAGTTTTCAATTGTTCTGAAGGCTTAGATTACAAAATGATGGGAAGATTTTTCTCGGGATTAGCTACGTCCGGCGCATGGTGTTGTTTTGATGAATTCAACCGTATTGACATTGAAGTGTTGTCTGTTATCGCTCAGCAACTCATTACGATTCGAAACGCTAAAGTCGCCAAACAAACAAGATTTATGTTTGAGGGACGAGAAATAAAATTAGTGCGCACTTGTGCTGCTTTCATCACAATGAATCCCGGTTACGCGGGAAGAACTGAACTACCCGACAATCTAAAGGCACTTTTCCGGCCAATCTCTATGATGGTACCGGATTACGCACTCATCGCAGAAGTTATTCTGTACTCTGAAGGCTTTGAATCGTCAAAAGGCCTAGCGAAGAAAATGGTTCAAATGTATAAGTTGTCTAGTGAACAACTATCAAAGCAAGACCATTATGATTTCGGAATGAGGGCTGTTAAAAGTGTGCTTGTAATGGCGGGCGCATTAAAAAGAGCTAATCCCGATCAACACGAGGAGATGACGCTTCTCTGCGCCTTGAACGACAGTAACTTGCCTAAGTTCTTAGCTGCAGACGCAATTTTGTTTGCCGGAATTCTGTCTGATTTATTCCCTGGCGTCAGTCTTCCCGCCAGGGATTACGGAGTTATGGAAGATGTCATCAAAATAATTATGTTGGAGCGTAAATTACAAATCGAAATATGTCAAATACGAAAGGTAATACAACTGCACGAGACGATGATAGTGCGTTGGGGCGTTATGTTAGTGGGACCGACCGGTGGAGGGAAAACTGTAGTACTACATGTGCTAGGTGACACGTACACACGGCTTTACGAAAACGGTGTTGAAGGCTCCCAATATCAACCCGTTCGCAAGTACATTATGAATCCGAAAAGTCTAACTATCGGCGAACTCTACGGAGAGGTCAATCTCCAAACACTCGAATGGCATGATGGTATTTTGCCACTGTGTCTCAGAACAGCAGTTCAGTGTTTAAACCCGGATCATCAATGGCTGATCTGCGACGGCCCTGTCGACGCTGTTTGGATTGAAAACATGAACACTGTACTGGACGATAATAAGATGCTTTGTCTCTCTAACTCCGAACGGATCAAATTAACGCCTTATGTGCATATGGTGTTCGAGGTAGCTGATTTAGCTCAAGCATCACCGGCCACCGTCTCACGTTGCGGTATGGTGTATATCGATCCGAACGAAATGGGATATTTGCCGTTCGTACGTTCTTGGCTACAAGAGGGCGTCGAAAAAAATCTATTCAATCAAGAGAATTCCGATTTTATATACGAACTGTTCAAGATGACGCAAGTCGGCTTAGACCACGTTAATTACAATTGTGGTGTTGGAATCAAACAGGTGGACATCAGCAAAGTGAGTGCGCAGTGCTTCCTGCTGGGTGCGCTACTCGCAGAGCCCGGAGATCGATTTGCGGATAAAGCTGCGTTGAAGATTTATATCGCTCATTGCTTCATATTTTGTTATGTGTGGTGTATTGGCGGGAACATTCTAGAAATGAATAGACAATCCTTTGAAGAAGTCATTAAACGACAATTTGAAGAATACGAAGAAGCCGAATATTACCCTCAGGGTTTCAATTTCTTTGACATGTACATGGACACGCGCCAACGTAAATTAAAAGTGTGGGCCGAGATCATTCCAGAATTCATATACGACTGTAATAAGCCGTTTTTCGAGACTTTAGTGCCTACAATCGACACAGTCCGCTACGGATATTTATTCGAGAAACTTCTCGGTGCCGGTAAACCTGTCATGTTTACCGGGAACACTGGTGTAGGTAAAACGTGTATAGCGGTCGAGATTCTAAACAGAATGTCGTTGACGGGATATTATGTGCCGGTCATATTGAATTTCTCGGCTCAAACAAGCAGCCCTCGCACGCAGGAGGTTATTGAGTTACGCTTAGATAAAAGGCCCAGAAAAGCAATCGGAGCTCCGCTTGGTAAGAAGATAATTATATTTATAGACGATGTGAACATGCCCAAATTAGATGTATATGGCGCTCAACCTACAATCGAATTGTTGAGGCAATTTCTCGACTTTGGTGGAGTATACGATCGAGACAAACTGTACTGGAAAGATATATTAGACGTTGTCCTATCTTGTTCATGTGCCCCTCCCGGTGGTGGTAGGAATCCACTGACCGCACGCTTCGTGAGGCATTTCGCAATGCTTTACATAGCTGCGCCTAACGCGGACGCAATGAAAACTATCTTTAAGGCAATCCTCAAAGGGCACATGGAGGATTTTGTACCCGAAGTTTCGGTCCTTGGAGAATCTATCGTCAATGCCGCTGTCGAAGTTTACCTTAAGATTTGCGCTGAATTATTACCAACGCCCGCAAAGTCTCATTACGTATTCAATCTACGTGATTTATCTAAATCTATGCAGGGTGTTTTGCAAGCACAAGCGGCCTATATGAGATCTCCACAAGGAATGCTGAGATTGTTCTATCATGAATGCCTTCGTGTATTTCACGACCGGTTAATAAATATACAGGATAAGAGTTATTTTTATCATCTAATGGCTTCAGTGTGTGAAAAGAACTTCCAAACTCCTATTTTAAGTGTTCCCGATGAACCGATCATTGAACATCCGCCTCTGTTGTTGTTCGGCGATTTTCTCAATTCATCCGTACCCAAAGAGAATAGAACATACCAAGAAATTCCAGACATCTCTAAGCTCATGATTGTATTGAAGGAATATTTGGATGAATACAATTCAACTGCTCGAGCTGAAATGCATTTAGTTCTTTTTCAAGACGCTGTTGAACATGTGGTTAGAGTGGCCAGGGTTTTCAGAGCCGAACGTGGGCATTGTCTCATGGTTGGTCCCGGGGGATCAGGCAGACGCAGTGTGGCTACCCTTGCTGGACATGTCAACGAATGCAAATGTTTGGGCATGGAGTTAAAGAGAAATTATGATACTCCAGAATTTCACGATGACCTTCGAATGATGTATATGAGGGCCGGTGTTAATTGTGAAGATACCGTTTTCTTATTTACGGACACGCAGATAACGAAGGAAGAATTTTTGGAAGATATAAATAATTTGTTGAATTCTGGTGAAGTGCCGAATCTCTTTGAAGGCGATTCATACGAGCAGGTACAGACTGGATGTCGAACTGAAGCAGCGAAAAGTGGAGTCAATCCCTCAGATAGGGACGGCGTCTATTATTTCTTCATTAACCGAGTTAGGGGGAAGCTGCACCTTTGCATCTGCATGAGCCCTGTAGGAGAAGCGTTCAGACGACGGTGCCGGATGTTTCCGTCCTTAGTTAATTGCTGCACGATAGATTGGTTCACGAAATGGCCTCCTGAAGCTTTATTGTCGGTCGCGCACCAATGCCTCCAGCCGCTCGGCAACCAAGAAATAATCACTAAAATATCTAAACTCTGCGTCACTATGCATCAGAATGTGGATATGATGACTGACCGGCTATACATGGAAATGAGGCGGTATTTCTACACTACGCCGAGCAGCTACCTTGATTTGTTGAAGCTGTATTTAGCGCTGCTCGATAAGAAACAACAGCAAATAATTAGAGGACGAGACAGAATTTCATGTGGATTACAGAAATTGTATGAAACATACGACGTTGTTGGAGTGATGGAACAACAGGTTCGCGAAATGGAACCAATACTGGCACGCAAAGCGGCCGAAAGTATCGCTTTGGTAGAAAGACTTAAAATTGAACAGAAAGCTGCTGACGAAGTTAAACAAGCAGTTATGAAAGACGAAGCTGAGGCTAAGATAAAAGCCGAAGAAGTGAAAGAGATTGCAGACGAAGCAAAAGCAGATCTCGCTTTAGCAATGCCAGCTATGGAGGCAGCTCAAAACGCCCTGAAAGCTCTCAATAAAGCAGACATAAATGAATTGAAAGCATTCCAAAAGCCTCCAGCTTTAGTTCGCTTTGTTATGGAGCCTGTTTGTATTTTGATGGGAGTCAAGCCCGACTGGGACTCGACCAAGAAGCTGTTGGCGGATGTGAATTTCATTGGTAAATTAGCAGACTATGATAAAGATCATATTCCTGATGCAACTCTGAAAAAGATTAAAGTGTATCTCACGCACAAAGATTTCAACCCTGATACTGTCGTTAAAGTTTCGAAGGTTTGTCGTTCAATGGTTCTGTGGGTGCAAGCAATAGATATGTACGCTAAAGTTTTCAGAGTTGTGGAACCGAAAATATTAAAACATAAAGAAGCCGCTGCCATTCTTAAAAGTGTTATGGCCGTGCTAAGAGCTAAACAAAAGGAAGTAGAAGCTATTGAAGCACAACTGGCGAAGATGATGGACGAGCTGAAAACGGTGGAAGATGAACGATTAAAGCTCCAAGCAGATGTTGACTTAGCAGCGGCGCGCCTGTCCCGTGCCGGTAAGCTGACTCAAGCTTTAGCCGATGAGAAAACGCGATGGGAAGAGAGCGTTAAGGCGGCTACACAACAACTTCATTGCACGACCGGTGATATCATTGTCGCATCTGGATGCATCGCATACTTTGGCGCGTTCCCGTCGCATTATCGACGCGAGCTGGAACTAAAGTGGATTGCGGAATGCTCGGAGCTGGAAATACCTTCCTCAAATACCTTCGACTTAATATTAGTGATGGCAGACTCGTATACTGTTCGTACTTGGAACTCTCAAGGGCTTCCGCGGGATGCAATATCGACTGAGAACGGTATATTGGTAACTAGGGCGGGTCGTTGGCCTCTTACGATCGACCCTCAGGAACAAGCCAACCGTTGGATTAAAAACATGGAGAGAGATAACGGTCTTCAGATAACTAAACTGAATGACCCGGGATATGTACGTATTCTGGAGAACTGTATACGACTTGGCTGGCCCATGCTTATTGAAGATCTGGGGGAGACGCTCGAGGCCACGTTGTCACCCGTCCTATTGAAACAGACTTTCCTTCAGGCAGGACGACTTCTGATACATCTAGGTGACAGTGACATTGAATACGATACGAATTTCCGTTTGTATATGACAACGAAATTAGCGAATCCCCACTATTTACCGGAGATATGCATACAAGTCACCCTTGTTAACTTTACGGTCACACTATCTGGCCTCGAGGATCAATTGTTAGCGGATGTAGTGCGACTGGAACGACCCGACTTGGAAATTCTTCGCACTGAACTAATCGTGCGCATCAACGCGGACAAGGCGACATTACTAGAAATCGAGGATAAAATCCTCAGACTTTTGTACGCGTCGTCTGGTAATATTTTGGACGACGAAGAACTCATAGAGACACTTAACGAAAGCAAGGAAACCTCTGAAATAATTAATGCTCGTCTCGAAGAAACCGAGGCGACCGAAATAAACATATCCGCAGCGCGAGAGAAGTACCGGACCGTAGCGACAAGGGGCGCGGTACTTTACTTCGCAGTGGCCCAATTAGCGGACATCGATCCTATGTATCAGTTCTCACTCAAGTACTTCAATCAGGTATTCAATGCAGTTATAGAGAAAAGTGAGAAATGCGACTTACTCGAAACCCGCCTTGAAATACTCCATAGAGAGATCACCTTGAACGTATATCGTAATGTTTCGCGAGGGCTCTTCGAAAGACACAAGCTGGTTTTCAGCTTTCTGTTGAACATGGCTGTATACCTGAACGACGGCTTAGTCACAATGGACGAGTGGAATTTCGTACTACGAGGACCGGCAGGAACTAAAGTGGTACCGCCCAAAAAGCCTAATATTGAATCACTTAGCGATCAAATGTGGCTCGCCGTTCATCACTTGGACGAGACCAATGAAAATTTCCGAGGCCTGGTGTCGGACTGTCTGAGGAGAATACCAATAACAATAGGCTCGTTCAATGTGGATATTCACGTGAACAACAACGACAAAACTCCACCGAAAATTAACTGGGATGAAAAGTTGTCCTCGTTTGAGAAATTAATGATTTTAAAATGCTTGAAAGAGGAAAAACTGGTGTTTGCGATCGCTCAATATGTTAGCACTAGCTTGGGTCACATGTTCATCGAAAGTCCAACCGTCCAACTAAATACATTATACGCAGATACTAACTGTGCGATTCCATTGGTCTTTGTCTTGAGCACGGGATCAGATCCATTTGGAGCCTTCCAGAAATTTGCAACCGAGATGGGTATGCGGGACCGTCTTCATTCTATATCATTAGGGCAAGGTCAGGGACCGGTTGCTGAGAAAATGATTAACAATGCTAAACCAAAAGGGGACTGGATATTTTTACAGAATTGTCATTTAGCAGCCTCCTGGATGTTAAGTCTAGAAGTAATCGTGGCCAATTTGGCAAGCGAGCACGGAACCCCACACTCAGACTTCAGACTGTACTTGAGTTCAATGCCTACCGCAAAATTCCCGGTGTCGGTGTTGCAAAACTCTGTTAAGGTCACCAACGAACCACCGAAGGGATTAAAGGCTAACGTCAAAAGGGCCCTTATAGAAATGGAAGAGGACTTCTTTGAAAATCATGTTCTGGGTCAGGATTGGCGAACAATGCTATTCGGTATTTGCATGTTTCATGCTATAATACAGGAACGAAAGAAGTTTGGTCCGCTCGGTTGGAATATTACATACGAATTCAATACAAGCGACCGGGAATGCGCCATGCTCAATCTTCAAATGTTCTGCGCCGACGGACACATACCGTGGGACGCGCTGGAGTATATCACAAGTCAGATAACGTACGGCGGCCGCGTGACCGACATGTGGGACCAACGTTGTTTGACAACCATCTTGAAATTGTTCTTCTCGGCCCCGACGCTCGAGGACGGCTATGTATACTCGCAGTCTGGTAGATATTACTGCCCCAGAGCGGATAAACTAGAAGCATACAAAGAGTACATGGATACTCTGCCCGTGATCGAAGTCCCCGAAGTGTTTGGAATGCACGATAATGCGAATATAGCGTTTGAGAACAAGGAGAGCAATACCCTGATACAGACAATAGTAGAGGTACAGCCGCGCGCGGGCGGCGGGGGCGGCGGCGATACACCTGATCAGATTGTGTGGCGGATCTGTGATCAAGTTCGATCGACCGTTTCGAAAAAGATAGATAAAGCCTCCGTGAACCCTGACCTAATGGTTCCTGACGATATGGGACAGTTACACTCCCTAACTACCGTACTCTTACACGAGACCGACAGATTCAACGCGCTTCTAGCTTTGATTCACTCGTCTCTTGGTGAACTACAAAAAGCTATTAAGGGAATAGTCGTCATGTCGGAAGCATTTGAAGAGGTTTTCAATGCGTTTTTGAATAATCGTGTGCCAGCAATGTGGCACAAGAAGGGCTACAATTCACTGAAGTCTCTCGGTAGCTGGATACACGATCTCGTGCTTCGAATAGATTTTATGGAGAAATGGTTAGTTGACGGTCTACAGCCCAGTAGTTGGGTGTCCGGGTTATTTTTCCCTCAAGGTCTGCTAACGGGCGCATTACAGTCCTACGCGCGAAGATATCGAGTGCCGATAGACGCACTCGTGTACGACTTCAAACCCATACCGTTTTTCTTATCGCAAGACGATGTTTACAAGCACAATAAGAAAAACATAAAGGATGGAGACGATGTGTTTGGAGCGCTGACAGTGCCCGAGGACGGTGTCAATATACACGGTCTATTTATTGATGCAGGCCGATGGGACTCCGAAAATAATTGTCTTGTCGACGCTTTAGCAGGTCAAATGAATCCTCCGCTGCCAGTGGTGTGGTTCTACCCGGTCCTCGAATTGCCAAAACCGGACCCACGTTACCAAGCGCCCCTCTACAAGACGTCAGAGAGAGCAGGCACTTTATCGACTACCGGGCACAGCACTAACTTCGTTCTACCGGTGTTGCTACCGACGCACATGCCACCCGATTTTTGGATCATACGTGGTACCGCCCTACTCACTCAAGTTACAGACTGA
Protein
MLADMLRIHVNFTPSRELLEGSALDEVLEVLPRQTDTCKWALFQVDAYVRPNGAVELNPSQEIISSYLEKITSYWDEHVRKFRQFLTEETLQMIVQPTIMGKQVEWSAGMSPNLYFLMNQDKKMLDDITFIPTSIKNAYECVWLFLNRMQAFMDSFKEAHEMDVNIIKQERDLNEFRKLCEKFVKQMEAIEDVVSYQPLGLIFLCLSPFQELFRPQPKRLFDVVLNVTPDIGRECIDGILEGVENISGDITKDPETASELVAFNFMLDGLESRVAFLEERLEYLRELYDLMGEFNIPIPPEDMTQFLGLSVTLSTLRSDVDARIESRSKLAGMFASQIGKDIMNLMLDVNKLRDEVTQPWLYDEKSDLEKVMETLDDLLEKLMACSARDKQIREWQKIFKIPPARLEQLDEAINDVKLRQLLWKASKEWNDMFKSWYDNPFNTLDVDEIQNTTISYGKIFNQLDKGLPSNTIVPKCKELIDVIKEKLPVISYLRNPALKPRHWVKIEEILHTRFTPDVVMNLQMFEELQAFQHSDELMEVAGQASSEAGLESLLKKVEEIWAALEFPVILHKDARDVYVLGGLDEIQASLDESNIHISTILSSRNCGPIKSRVEEWAKNLELFAKTLEEWYACQQTWMYLEVIFSAPDIQRQLPNETRLFSIVDKSWKDIMRKLAKVPLAMPAATQPKLYEEFVRNNEMLDQIMKCLEAYLETKRVAFPRFFFLSNDELLEILAQTRNPHAVQPHLRKCFDAIAKLEFGVKFPESEMEIAEDGTLVEKEMSFQTRDMLQAKLAKTASPEDLTTDIVAMLSPEGERVNLGKGLKARGNVEDWLGKVEEAMFASVKRCMKFALKEYMVNERVDWVEMHPNQVVLTVSQIMWAKGVHEVFNLEIPLRIDTGLLSYEKKCISDLNDLAALTRKDLTLLFRKVLCALITIDVHARDTISHMVEKHVQKANDFEWLKMIRYYWEEDIDNCVARMSSAMYIYGHEYLGAGGVLVITPLTDRCYLCLMGALQLDLGGAPAGPAGTGKTETTKDLAKSLAIQCVVFNCSEGLDYKMMGRFFSGLATSGAWCCFDEFNRIDIEVLSVIAQQLITIRNAKVAKQTRFMFEGREIKLVRTCAAFITMNPGYAGRTELPDNLKALFRPISMMVPDYALIAEVILYSEGFESSKGLAKKMVQMYKLSSEQLSKQDHYDFGMRAVKSVLVMAGALKRANPDQHEEMTLLCALNDSNLPKFLAADAILFAGILSDLFPGVSLPARDYGVMEDVIKIIMLERKLQIEICQIRKVIQLHETMIVRWGVMLVGPTGGGKTVVLHVLGDTYTRLYENGVEGSQYQPVRKYIMNPKSLTIGELYGEVNLQTLEWHDGILPLCLRTAVQCLNPDHQWLICDGPVDAVWIENMNTVLDDNKMLCLSNSERIKLTPYVHMVFEVADLAQASPATVSRCGMVYIDPNEMGYLPFVRSWLQEGVEKNLFNQENSDFIYELFKMTQVGLDHVNYNCGVGIKQVDISKVSAQCFLLGALLAEPGDRFADKAALKIYIAHCFIFCYVWCIGGNILEMNRQSFEEVIKRQFEEYEEAEYYPQGFNFFDMYMDTRQRKLKVWAEIIPEFIYDCNKPFFETLVPTIDTVRYGYLFEKLLGAGKPVMFTGNTGVGKTCIAVEILNRMSLTGYYVPVILNFSAQTSSPRTQEVIELRLDKRPRKAIGAPLGKKIIIFIDDVNMPKLDVYGAQPTIELLRQFLDFGGVYDRDKLYWKDILDVVLSCSCAPPGGGRNPLTARFVRHFAMLYIAAPNADAMKTIFKAILKGHMEDFVPEVSVLGESIVNAAVEVYLKICAELLPTPAKSHYVFNLRDLSKSMQGVLQAQAAYMRSPQGMLRLFYHECLRVFHDRLINIQDKSYFYHLMASVCEKNFQTPILSVPDEPIIEHPPLLLFGDFLNSSVPKENRTYQEIPDISKLMIVLKEYLDEYNSTARAEMHLVLFQDAVEHVVRVARVFRAERGHCLMVGPGGSGRRSVATLAGHVNECKCLGMELKRNYDTPEFHDDLRMMYMRAGVNCEDTVFLFTDTQITKEEFLEDINNLLNSGEVPNLFEGDSYEQVQTGCRTEAAKSGVNPSDRDGVYYFFINRVRGKLHLCICMSPVGEAFRRRCRMFPSLVNCCTIDWFTKWPPEALLSVAHQCLQPLGNQEIITKISKLCVTMHQNVDMMTDRLYMEMRRYFYTTPSSYLDLLKLYLALLDKKQQQIIRGRDRISCGLQKLYETYDVVGVMEQQVREMEPILARKAAESIALVERLKIEQKAADEVKQAVMKDEAEAKIKAEEVKEIADEAKADLALAMPAMEAAQNALKALNKADINELKAFQKPPALVRFVMEPVCILMGVKPDWDSTKKLLADVNFIGKLADYDKDHIPDATLKKIKVYLTHKDFNPDTVVKVSKVCRSMVLWVQAIDMYAKVFRVVEPKILKHKEAAAILKSVMAVLRAKQKEVEAIEAQLAKMMDELKTVEDERLKLQADVDLAAARLSRAGKLTQALADEKTRWEESVKAATQQLHCTTGDIIVASGCIAYFGAFPSHYRRELELKWIAECSELEIPSSNTFDLILVMADSYTVRTWNSQGLPRDAISTENGILVTRAGRWPLTIDPQEQANRWIKNMERDNGLQITKLNDPGYVRILENCIRLGWPMLIEDLGETLEATLSPVLLKQTFLQAGRLLIHLGDSDIEYDTNFRLYMTTKLANPHYLPEICIQVTLVNFTVTLSGLEDQLLADVVRLERPDLEILRTELIVRINADKATLLEIEDKILRLLYASSGNILDDEELIETLNESKETSEIINARLEETEATEINISAAREKYRTVATRGAVLYFAVAQLADIDPMYQFSLKYFNQVFNAVIEKSEKCDLLETRLEILHREITLNVYRNVSRGLFERHKLVFSFLLNMAVYLNDGLVTMDEWNFVLRGPAGTKVVPPKKPNIESLSDQMWLAVHHLDETNENFRGLVSDCLRRIPITIGSFNVDIHVNNNDKTPPKINWDEKLSSFEKLMILKCLKEEKLVFAIAQYVSTSLGHMFIESPTVQLNTLYADTNCAIPLVFVLSTGSDPFGAFQKFATEMGMRDRLHSISLGQGQGPVAEKMINNAKPKGDWIFLQNCHLAASWMLSLEVIVANLASEHGTPHSDFRLYLSSMPTAKFPVSVLQNSVKVTNEPPKGLKANVKRALIEMEEDFFENHVLGQDWRTMLFGICMFHAIIQERKKFGPLGWNITYEFNTSDRECAMLNLQMFCADGHIPWDALEYITSQITYGGRVTDMWDQRCLTTILKLFFSAPTLEDGYVYSQSGRYYCPRADKLEAYKEYMDTLPVIEVPEVFGMHDNANIAFENKESNTLIQTIVEVQPRAGGGGGGDTPDQIVWRICDQVRSTVSKKIDKASVNPDLMVPDDMGQLHSLTTVLLHETDRFNALLALIHSSLGELQKAIKGIVVMSEAFEEVFNAFLNNRVPAMWHKKGYNSLKSLGSWIHDLVLRIDFMEKWLVDGLQPSSWVSGLFFPQGLLTGALQSYARRYRVPIDALVYDFKPIPFFLSQDDVYKHNKKNIKDGDDVFGALTVPEDGVNIHGLFIDAGRWDSENNCLVDALAGQMNPPLPVVWFYPVLELPKPDPRYQAPLYKTSERAGTLSTTGHSTNFVLPVLLPTHMPPDFWIIRGTALLTQVTD

Summary

Description
Force generating protein of respiratory cilia. Produces force towards the minus ends of microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP (By similarity).
Force generating protein of cilia required for sperm flagellum motility. Produces force towards the minus ends of microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP. Required in spermatozoa for the formation of the inner dynein arms and biogenesis of the axoneme (PubMed:24360805).
Force generating protein of cilia required for sperm flagellum motility (PubMed:11371505). Produces force towards the minus ends of microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP (By similarity). Required in spermatozoa for the formation of the inner dynein arms and biogenesis of the axoneme (By similarity).
Force generating protein of respiratory cilia. Produces force towards the minus ends of microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP. Involved in sperm motility; implicated in sperm flagellar assembly (By similarity).
Force generating protein of respiratory cilia. Produces force towards the minus ends of microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP. Involved in sperm motility; implicated in sperm flagellar assembly (By similarity). Probable inner arm dynein heavy chain.
Force generating protein of respiratory cilia. Produces force towards the minus ends of microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP. Involved in sperm motility; implicated in sperm flagellar assembly.
Force generating protein of respiratory cilia. Produces force towards the minus ends of microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP. Required for structural and functional integrity of the cilia of ependymal cells lining the brain ventricles.
Force generating protein of cilia required for sperm flagellum motility. Produces force towards the minus ends of microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP. Required in spermatozoa for the formation of the inner dynein arms and biogenesis of the axoneme (By similarity).
May function as a motor for intraflagellar retrograde transport. Functions in cilia biogenesis. May play a role in transport between endoplasmic reticulum and Golgi or organization of the Golgi in cells (By similarity).
May function as a motor for intraflagellar retrograde transport. Functions in cilia biogenesis. According to PubMed:8666668, it may play a role in transport between endoplasmic reticulum and Golgi or organization of the Golgi in cells.
May function as a motor for intraflagellar retrograde transport. Functions in cilia biogenesis (By similarity).
Functions as a motor for intraflagellar retrograde transport in chemosensory neurons (PubMed:10545497, PubMed:28479320). Functions in cilia biogenesis (PubMed:10545497, PubMed:27515926).
Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP. Plays a role in mitotic spindle assembly and metaphase plate congression (PubMed:27462074).
Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP. Plays a role in mitotic spindle assembly and metaphase plate congression.
Cytoplasmic dynein acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP. Required to maintain uniform nuclear distribution in hyphae. May play an important role in the proper orientation of the mitotic spindle into the budding daughter cell yeast. Probably required for normal progression of the cell cycle.
Cytoplasmic dynein acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules (By similarity). Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP (By similarity). May play a role in nuclear migration in hypodermal precursor cells (PubMed:20005871, PubMed:27697906). May be involved in the transport of synaptic vesicle components towards the axon of the DA motor neuron (PubMed:20510931). This function may involve the regulation of dynein by pct-1 and/or cdk-5 (PubMed:20510931). Involved in the formation of synapses in the dorsal region during synaptic remodeling of DD motor neurons (PubMed:21609829). Required for anterograde trafficking of dense-core vesicles in the DB motor neuron dendrites (PubMed:22699897). Required for the formation of dendritic branches of PVD sensory neurons (PubMed:21205795). May also play a role in GABAergic synaptic vesicle localization in the ventral nerve cord (PubMed:16996038). May play a role in the pairing of homologous chromosomes during meiosis (PubMed:26483555).
May function as a motor for intraflagellar retrograde transport. Functions in flagellar biogenesis.
Acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP (By similarity).
Cytoplasmic dynein acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP. Required for nuclear movement during meiotic prophase.
Subunit
The dynein complex consists of at least two heavy chains and a number of intermediate and light chains.
Consists of at least two heavy chains and a number of intermediate and light chains.
The I1 inner arm complex (also known as the f dynein complex) is a two-headed isoform composed of two heavy chains (1-alpha and 1-beta), three intermediate chains and three light chains. I1 occupies a specific position proximal to the first radial spoke and repeats every 96 nm along the length of the axoneme.
Consists of at least two heavy chains (alpha and beta), three intermediate chains and several light chains.
Consists of at least 3 heavy chains (alpha, beta and gamma), 2 intermediate chains and 8 light chains.
Interacts with DNAL1 (By similarity). Consists of at least two heavy chains and a number of intermediate and light chains.
Interacts with DNAL1 (PubMed:21496787). Consists of at least two heavy chains and a number of intermediate and light chains.
The cytoplasmic dynein complex 2 is probably composed by a heavy chain DYNC2H1 homodimer and a number of DYNC2LI1 light intermediate chains.
The cytoplasmic dynein complex 2 is probably composed by a heavy chain DYH1B homodimer and a number of light intermediate chains.
The cytoplasmic dynein complex 2 is probably composed by a heavy chain che-3 homodimer and a number of light intermediate chains.
Homodimer. The cytoplasmic dynein 1 complex consists of two catalytic heavy chains (HCs) and a number of non-catalytic subunits presented by intermediate chains (ICs), light intermediate chains (LICs) and light chains (LCs); the composition seems to vary in respect to the IC, LIC and LC composition. The heavy chain homodimer serves as a scaffold for the probable homodimeric assembly of the respective non-catalytic subunits. The ICs and LICs bind directly to the HC dimer and dynein LCs assemble on the IC dimer. Interacts with DYNC1LI1; DYNC1LI1 and DYNC1LI2 bind mutually exclusive to DYNC1H1. Interacts with DYNC1LI2; DYNC1LI1 and DYNC1LI2 bind mutually exclusive to DYNC1H1. Interacts with DYNC1I2 (By similarity). Interacts with BICD2 (PubMed:25512093).
Homodimer. The cytoplasmic dynein 1 complex consists of two catalytic heavy chains (HCs) and a number of non-catalytic subunits presented by intermediate chains (ICs), light intermediate chains (LICs) and light chains (LCs); the composition seems to vary in respect to the IC, LIC and LC composition. The heavy chain homodimer serves as a scaffold for the probable homodimeric assembly of the respective non-catalytic subunits. The ICs and LICs bind directly to the HC dimer and dynein LCs assemble on the IC dimer (PubMed:2140361). Interacts with DYNC1LI1; DYNC1LI1 and DYNC1LI2 bind mutually exclusive to DYNC1H1. Interacts with DYNC1LI2; DYNC1LI1 and DYNC1LI2 bind mutually exclusive to DYNC1H1. Interacts with DYNC1I2 (PubMed:10893223). Interacts with BICD2 (By similarity).
Homodimer. The cytoplasmic dynein 1 complex consists of two catalytic heavy chains (HCs) and a number of non-catalytic subunits presented by intermediate chains (ICs), light intermediate chains (LICs) and light chains (LCs); the composition seems to vary in respect to the IC, LIC and LC composition. The heavy chain homodimer serves as a scaffold for the probable homodimeric assembly of the respective non-catalytic subunits. The ICs and LICs bind directly to the HC dimer and dynein LCs assemble on the IC dimer. Interacts with DYNC1LI1; DYNC1LI1 and DYNC1LI2 bind mutually exclusive to DYNC1H1. Interacts with DYNC1LI2; DYNC1LI1 and DYNC1LI2 bind mutually exclusive to DYNC1H1. Interacts with DYNC1I2 (By similarity). Interacts with BICD2 (PubMed:22956769).
The dynein complex consists of at least two heavy chains and a number of intermediate and light chains. Interacts with DYN3.
The cytoplasmic dynein complex 2 is probably composed by a DHC1B homodimer and a number of D1BLIC light intermediate chains. Interacts with FAP133, FLA10 and LC8.
Miscellaneous
Mice homozygous for Dync2h1 null alleles die at approximately 12.5 dpc with abnormal brain morphology, frequent heart-looping and occasionally with polysyndactily. Cilia have abnormal morphology.
Present with 195 molecules/cell in log phase SD medium.
Similarity
Belongs to the dynein heavy chain family.
Keywords
Alternative splicing   ATP-binding   Cell projection   Cilium   Coiled coil   Complete proteome   Cytoplasm   Cytoskeleton   Dynein   Microtubule   Motor protein   Nucleotide-binding   Polymorphism   Reference proteome   Repeat   Ciliopathy   Disease mutation   Flagellum   Kartagener syndrome   Primary ciliary dyskinesia   TPR repeat   RNA editing   Glycoprotein   3D-structure   Direct protein sequencing   Kelch repeat   Phosphoprotein   Ubl conjugation pathway   Cell membrane   Developmental protein   Membrane   Karyogamy   Acetylation   Cell cycle   Cell division   Charcot-Marie-Tooth disease   Mental retardation   Mitosis   Neurodegeneration   Neuropathy   Transport   Neurogenesis   Merozoite  
Feature
chain  Dynein heavy chain 6, axonemal
splice variant  In isoform 2.
sequence variant  Found in a patient with azoospermia; unknown pathological significance; dbSNP:rs61731722.
Pubmed
14702039    17974005    15815621    15489334    8812413    11175280    + More
11214970    28206990    10718198    16641997    9373155    9256245    24360805    25927852    27798045    28552195    29449551    16141072    19468303    11371505    19131326    21183079    11877439    10231032    15057822    7657712    8741840    10493829    16959974    10819331    16625196    20835228    10888669    10069812    2957507    2137128    9008712    16541075    19159218    1830927    1833761    11250194    1830928    11247663    9205841    11104725    10459015    8889521    9247642    9545504    18669648    12142464    12853948    18022865    25186273    15368895    8006077    12297094    14574404    18691976    10602986    16054618    11912187    11788826    15269178    11062149    10997877    21496787    16627867    7516341    9186009    8134356    16372000    19146970    7929559    12712197    11489260    8666668    16554811    8186465    12056414    16440056    21211617    21269460    19361615    19442771    22499340    23456818    16061793    12432068    11907264    16229832    8832411    9450951    9851916    10545497    27515926    28479320    11181180    15001715    23749448    8089180    10731132    12537572    8186464    12537569    8227145    14654843    17081983    19690332    19608861    20068231    22223895    23186163    24275569    25944712    27462074    21076407    21820100    22368300    22847149    22459677    23033978    23603762    25512093    24307404    25484024    26846447    28193117    7690137    7684232    2140361    10893223    12730604    18034455    22956769    23806337    8248224    8196765    24374639    8234262    14562095    14562106    15642746    8589455    8056840    8674131    16996038    20510931    20005871    20599902    21205795    21609829    22699897    26483555    27697906    27864381    12802074    17932292    9971742    15269286    17895364    12368864    17653272    10366596    11859360    12368867    12693554    12975309   
EMBL
AK027182    AK094676    AL512706    AC010087    AC096770    AC098975    + More
AC109827    CH471053    BC015442    BC104884    BC113424    BC117259    BC143666    U61736    AJ132086    AB051484    AB037831    AK023766    AK074130    AK125990    AB290163    AC092045    KF459588    AJ132083    AJ132094    U61738    Z83804    U83571    AY221994    AL117428    AK053204    AC108416    CH466573    BC023155    Z83815    AF327442    AB023161    AK094515    CR749651    AC013274    AC068919    AC104600    AC114760    BC029567    AJ132084    AJ132093    Z83801    AABR03068169    AABR03068266    AABR03068762    AABR03068958    AABR03068975    AABR03069173    AABR03069339    AABR03069471    AABR03070154    AABR03071231    AABR03071501    AABR03071646    AABR03071706    AABR03071857    AABR03072256    D26498    U32180    AL596125    AL731687    Z83813    AK029791    AF494040    AK056509    CH471228    AJ132085    AJ132092    Z83805    U83574    BC019878    AL096732    AC002394    AB040936    AK128517    AK292607    AC025335    AC087388    BC034225    U83570    AC122853    AC131702    Z83816    BC051401    AK053178    AJ242523    AJ242524    AJ242525    AJ132799    AC079315    AC117503    AK095581    AK125475    AK125796    AB095937    AJ132089    X59603    D01021    AF257737    AJ404468    AC005209    AC005410    AC005701    BC128421    AB002355    AJ132088    AJ243806    U61364    AC016182    AC061992    KF510431    AK097776    BC105107    Z83799    AL122077    AJ000522    AJ320497    AC004595    AC102952    AC073102    AC013481    AC005078    AC004002    AC099653    AJ132087    AL591204    AL591433    Z83807    AK173343    U02963    AF356519    AL034345    AL035555    AL035690    AL353700    AL391415    Z83806    AJ132091    AF356520    AF356521    AF356522    AF356523    AF363577    AF342999    AC165951    AC165962    AC166166    AC174471    AF117305    Z83817    AK133238    AF466704    AC131997    AC154880    AK052643    AY045575    AY049075    U61735    AB046823    AK026756    U15303    AABR03100255    AABR03101829    AABR03101330    D26492    L26049    U03904    AACD01000004    BN001308    L31504    CM002239    U84215    AABR03100937    AABR03102926    AABR03102110    AABR03100400    AABR03102032    AABR03101661    AABR03100963    AY032856    AC121919    AC133179    AK076605    AK132980    AK097746    AK126276    AK128592    AC092418    AC093928    AC121250    U53532    AB231765    AB231766    AP000817    AP001486    AP002829    AP002961    AP003382    AP003461    AK021818    AK095579    AK125524    AK131453    U53531    U20552    Z83800    BX538093    AB082528    DQ104402    AK014500    AK032860    AK045978    AK046538    AK083433    AK084796    AC155908    CT010499    AY452064    AY452065    AY452066    AY452067    Z83809    AK173324    AB041881    U61748    D26495    U03969    AABR07008948    Z75536    AF287477    AE016816    L23195    AE014296    L25122    AY051501    AB002323    AB290157    AY682080    U53530    L23958    BC021297    D13896    L08505    AY004877    AC152827    Z21877    L15626    Z28279    BK006944    U20449    L17132    L33260    BX284601    AJ132478    DS496110    AF096277    AE014186    AAN35824.1    AB006784    CU329670    AL844506    AK057314    AK093028    BC111765    BC117301    BC117303    AC009796    AC084337    CH471064    AK074178    AL137619    AY358770   
Pfam
PF08393   DHC_N2        + More
PF12774   AAA_6
PF12781   AAA_9
PF12780   AAA_8
PF18198   AAA_lid_11
PF03028   Dynein_heavy
PF17857   AAA_lid_1
PF12777   MT
PF17852   Dynein_AAA_lid
PF18199   Dynein_C
PF08385   DHC_N1
PF07646   Kelch_2
PF01833   TIG
PF00630   Filamin
PF07728   AAA_5
Interpro
IPR003593   AAA+_ATPase        + More
IPR041466   Dynein_AAA5_ext       
IPR042219   AAA_lid_11_sf       
IPR004273   Dynein_heavy_D6_P-loop       
IPR013602   Dynein_heavy_dom-2       
IPR035699   AAA_6       
IPR041658   AAA_lid_11       
IPR041228   Dynein_C       
IPR042228   Dynein_2_C       
IPR042222   Dynein_2_N       
IPR041589   DNAH3_AAA_lid_1       
IPR035706   AAA_9       
IPR024743   Dynein_HC_stalk       
IPR024317   Dynein_heavy_chain_D4_dom       
IPR027417   P-loop_NTPase       
IPR026975   DNAH1       
IPR026983   DHC_fam       
IPR002048   EF_hand_dom       
IPR018247   EF_Hand_1_Ca_BS       
IPR013594   Dynein_heavy_dom-1       
IPR030443   DNAH9       
IPR011043   Gal_Oxase/kelch_b-propeller       
IPR017868   Filamin/ABP280_repeat-like       
IPR011498   Kelch_2       
IPR001736   PLipase_D/transphosphatidylase       
IPR014756   Ig_E-set       
IPR015915   Kelch-typ_b-propeller       
IPR002909   IPT_dom       
IPR001298   Filamin/ABP280_rpt       
IPR013783   Ig-like_fold       
IPR026815   DYNC2H1       
IPR011704   ATPase_dyneun-rel_AAA       
SUPFAM
SSF52540   SSF52540        + More
SSF117281   SSF117281       
SSF81296   SSF81296       
SSF50965   SSF50965       
PDB
4RH7     E-value=0,     Score=2716

Ontologies

GO
GO:0045503   GO:0007018   GO:0060285   GO:0030286   GO:0051959   GO:0045505   GO:0008569   GO:0005874   GO:0005858   GO:0005524   GO:0030317   GO:0060294   GO:0036159   GO:0003351   GO:0005930   GO:0003777   GO:0036126   GO:0036156   GO:0003341   GO:0007288   GO:0005929   GO:0005829   GO:0005509   GO:0031514   GO:0008017   GO:0030030   GO:0005737   GO:0120135   GO:0097729   GO:0035545   GO:1905419   GO:0061371   GO:0007368   GO:0007611   GO:0120134   GO:0003356   GO:0060411   GO:0060287   GO:0097728   GO:0036157   GO:0036158   GO:0097228   GO:0021670   GO:0007507   GO:0060271   GO:0005881   GO:0072382   GO:0031122   GO:0030428   GO:0000278   GO:0070789   GO:0001411   GO:0005938   GO:0007097   GO:0016887   GO:0015631   GO:0005868   GO:0047496   GO:0051293   GO:0016567   GO:0070062   GO:1905515   GO:0005886   GO:0035721   GO:0061512   GO:0009953   GO:0005794   GO:0030326   GO:0060976   GO:0003774   GO:0045880   GO:0097542   GO:0007030   GO:0021522   GO:0016485   GO:0045177   GO:0030900   GO:0035735   GO:0030182   GO:0007275   GO:0043053   GO:0008104   GO:0060170   GO:0007635   GO:0030512   GO:0097730   GO:0061066   GO:0005816   GO:0000132   GO:0000741   GO:0000070   GO:0000235   GO:0030473   GO:0098958   GO:0048813   GO:0007098   GO:0045169   GO:0007298   GO:0042623   GO:0007052   GO:0007312   GO:0007405   GO:0045198   GO:0050658   GO:0008090   GO:0016319   GO:0040001   GO:0007051   GO:0030723   GO:0035149   GO:0034501   GO:0030071   GO:0008088   GO:0051237   GO:0005875   GO:0051683   GO:0048477   GO:0048134   GO:0007282   GO:0051642   GO:0035011   GO:1904115   GO:1904801   GO:0006886   GO:0046604   GO:0045197   GO:0007279   GO:0000776   GO:0007349   GO:0045478   GO:0007294   GO:0040003   GO:0034063   GO:1990904   GO:0048311   GO:0008298   GO:0097711   GO:0051301   GO:0090235   GO:0032388   GO:0043312   GO:0060236   GO:0120162   GO:0010389   GO:0030175   GO:0035578   GO:0000086   GO:1905832   GO:0033962   GO:0005813   GO:0019886   GO:0003723   GO:0016020   GO:0006888   GO:0005576   GO:0030424   GO:1905243   GO:1990090   GO:0043025   GO:0007286   GO:0002177   GO:0005635   GO:0005819   GO:1990048   GO:0051296   GO:1902473   GO:0000922   GO:1904811   GO:0051932   GO:0048814   GO:0045202   GO:0048489   GO:0051661   GO:0016322   GO:0030990   GO:0072594   GO:0044458   GO:0097014   GO:0051315   GO:0000742   GO:0035974   GO:0007129   GO:0030981   GO:1990758   GO:0030989   GO:1990574   GO:0006813   GO:0006810   GO:0009072   GO:0007169   GO:0016021  

Topology

Subcellular location
  
Cytoplasm  
Cytoskeleton  
Cilium axoneme  
Cell projection  
Cilium  
Flagellum  
Flagellum axoneme  
Cell membrane   Localizes to the apical cytoplasm (By similarity). According to PubMed:8666668, it localizes to Golgi apparatus, cytoplasmic vesicle and endoplasmic reticulum (PubMed:8666668).   With evidence from 4 publications.
Cilium membrane  
Flagellum basal body  
Flagellum membrane  
Microtubule organizing center  
Spindle pole body  
Length:
3694
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.74048000000002
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00170
outside
1  -  3694
 
 

Population Genetic Test Statistics

Pi
4.803594
Theta
18.559713
Tajima's D
-1.915554
CLR
0.054187
CSRT
0.0192490375481226
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号