SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00314
Pre Gene Modal
BGIBMGA000537
Annotation
PREDICTED:_uncharacterized_protein_LOC101743416_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.626
 

Sequence

CDS
ATGAATGGAGAAATAAATGGAATTATGGATAAATCATTAGATTCACCTGCAGACCTATCTAACATACAAGATGACCATAAGAATTCAGATGCTAAAGATGATCATGATGACACTGAAAGTGATAGTAGTACCAATGTGAAAGGTAGTGTATTGATAACTCAAAGTATTACGGTAGATGATGGTTCTTCCATTGAAACCAAAACTAATAGTGATTCCGAGCAGTCTGACAGCAACAGTATTCATAATAATGATGATAAGATAATACTTGTACGTGAAGCTGGTACTGTAAAAATGGCCATCCAAGATGATAACTGTGTTACTGCAGAAAATGAATGTGGAAACAGCAATGACTCTTATACTGGTTCAGAAACCAGTTCACAGGCTAAGTCTATAGAGCAACTCAAAATCACCAGTATTGATATAAAATATAATTATACAGGAAAAGACACTTCAAATAGTTGTGACAATACACAAAACTCAGATAATACAGAGGAATCATCAGATGATTGTTCTGAGCCTAAAGCAGATGATGCAGTAAGCATCAACTCTGACTCTGGCGATGATGGATCTTCACAGGGAAGTGACAATAAACTTAAAAGAACAGAGGTAATCTTGATAGATAATGATAGGTCAGATACACAAAATGGGAATTCACATGATGCTCACAGTCCAGAAGTCCATGAAATAGAAAGTGATAATGATGAAACATTTACTGAACCAGTAGTAGAAAAACCAAAATCAAATACAAATAATAGCAAAACAGTTCTTAGAAGAAGCAGTAGAACAATAAAGAGGAGGAAATTCAGTGATGAAATAGAAAATGGTGATGACTCAGAAGTGGAAGAAATAGAAATGCTGGATCCTTTACGGCATAAAATGAGACCAATAGTCATCAATGATACTAAAACATTGGTTGAGATGGCAGCAAAACATACAAAGGCAAGTCAGAATGACAATAAGAAGAAAGAACCAACAGTTGTTATAATTGATACACATGCTAACAAGCAAACAATAAACAAAACACAACCTTCAATTAATTCTACAAATGCTCAAACTTTATATCAGAATATGATTGCTCGTGGAACTACAGTTACCCCTGTTAGTAGTAAAAGTAATGCAACAAACAATAATAGCTCCTCACAGACTCAAACAATTCTACCCTCACTTACAGATGATATGTATGTGGTTGAAGCACCATCTTTTATTGTACCATACGTGTACGAAAAACCCTCTTTGCAACCTTTTAGAGAATTTGTAGACATATTAGGTAAAGAGCTAGAAGAACAAAAAGCCAAAGAAGACAAAGAGCGATTAGAAAAAAATAACAAAGAGAAAGAGAAAAGAGCCAAGGAAATGCATGAAAAAATAACCAAAGGAGAAGAAGAAGTAGAGGAATCTGAAGAAGATGTGGATATGGAGAAAAAGAAGAAAACTGAAAAAAGAGAGCGACGAAGGCATGGGAATGATGATGATGATGCATCTTGGGATGGTGAGTCATCTTCAGAGTCTGAAGATGATGTAATTAGTGATGAAGAAGATAAAATTCTCAAAGATAAAGTTGATCCAATAGATGATATCAAGGATGTGACTGATATAGTAACTGACAAAACCGTTGGTAAATCTGAGAGCTACTTTGATTGTTCACTAGGCAAATTTTTTATGGATATTGGTTACAACCTTGTTCAAGAATTTGTACAAAGTGATTTGCTCAAACAGCAGAACCGTAAATTAAACAGGGAAAAGAAATCTGGCCATAGCACAAAGGCTACCGAATCATCAATAGCATCGCTCATGAAAAATTTGGAATTAAGCAAAGAAAATAATGCACCTTATGCTTATCTGCAGAATAAATGTCAATTTTGCACCTTTAAGACTGAGTCTACCCTTGTAATGGCCAATCATTTAGAAACACCTCACATGAAAAATAATTTGTACAAGTGTAACTTTTGTGAATTTGAAATTCGAAGCCCACATGATATTTTGAGGCATATGAAAGCTGAGCATAATATTGTAGGTAAATTAGAAAAAGCTCCATCTTATCACGAGTGTCCTAATTGCCCGTTTGAAGATAATGGTAAGGGTAAATTAGCTCGTCATCAAATACCTTGTGCTAAAAAATTTAAACCAGCTATCAATTTATCACCACCAATTGAATGGGAGCCCCCAGCAAAAATACCAAAGATAACAAAATCGCGTAGTAATGTGATGGGCCCGTATCAAAACCAGTTTAACCGCCATGTTGGTAATAATATTAACAGGCCAATGTCAGTAACAAATATGGCACCAGGAGGCAGTTTCCGCCCTCGAGGTAGAGCACCATTGTCAATGCCTCCTCGGGGCGCACCCATACCTGTTCATGGAGCTCCTATTATACGTGGAGGTGTTATGATTAGGCATAATTCTCCTGCTGCTTCTTCAAATTATCCGACAAAAAATAAGCCAGGGCAGCAGCCATCTATATCGATAACGCCCTTGCCACGGCAACCGCAACCTGCACAGGCAGTTCAGAATGTGCAGGCATCAAAAGGCTCGTTTGTGATTTGCGAGATCTGTGATGGTTACATAAAAGACCTAGAGCAATTGCGAAATCATATGCAATGGATTCACAAAGTTAAAATTCACCCAAAAATGATCTACAACAGACCACCACTGAACTGCCAGAAATGTCAATTTAGGTTTTTCACTGACCAAGGTTTGGAACGACATTTATTAGGCTCGCATGGTCTTGTTACTAGTTCTATGCAAGAAGCAGCAAATAAAGGCAAAGATGCAGGCCGATGTCCAGTTTGTGGCAGAGTATATCAATGGAAACTTCTTAATCATGTTGCTCGTGATCACAATCTAACATTAAAGCCAGCACATTTGTCTTATAAATGTACCGTGTGTACTGCCACATTCGGAATGTATAAACTGTTCGAGAACCATGTTTATTCAGCTCATAGTGTAGTTGCAAAACGCGTTATGGACAAAAACAAAAATAATACACCATCTGCCAAAGCTTCAGCAAACAACGACTCACTCTTGAAACCCTTGAAGATAAATGATGAGATTACTATTATCCCACAGCCAGTTAAAGCAAGTGCTGCTAATTGTGCTAAAGATAAATAA
Protein
MNGEINGIMDKSLDSPADLSNIQDDHKNSDAKDDHDDTESDSSTNVKGSVLITQSITVDDGSSIETKTNSDSEQSDSNSIHNNDDKIILVREAGTVKMAIQDDNCVTAENECGNSNDSYTGSETSSQAKSIEQLKITSIDIKYNYTGKDTSNSCDNTQNSDNTEESSDDCSEPKADDAVSINSDSGDDGSSQGSDNKLKRTEVILIDNDRSDTQNGNSHDAHSPEVHEIESDNDETFTEPVVEKPKSNTNNSKTVLRRSSRTIKRRKFSDEIENGDDSEVEEIEMLDPLRHKMRPIVINDTKTLVEMAAKHTKASQNDNKKKEPTVVIIDTHANKQTINKTQPSINSTNAQTLYQNMIARGTTVTPVSSKSNATNNNSSSQTQTILPSLTDDMYVVEAPSFIVPYVYEKPSLQPFREFVDILGKELEEQKAKEDKERLEKNNKEKEKRAKEMHEKITKGEEEVEESEEDVDMEKKKKTEKRERRRHGNDDDDASWDGESSSESEDDVISDEEDKILKDKVDPIDDIKDVTDIVTDKTVGKSESYFDCSLGKFFMDIGYNLVQEFVQSDLLKQQNRKLNREKKSGHSTKATESSIASLMKNLELSKENNAPYAYLQNKCQFCTFKTESTLVMANHLETPHMKNNLYKCNFCEFEIRSPHDILRHMKAEHNIVGKLEKAPSYHECPNCPFEDNGKGKLARHQIPCAKKFKPAINLSPPIEWEPPAKIPKITKSRSNVMGPYQNQFNRHVGNNINRPMSVTNMAPGGSFRPRGRAPLSMPPRGAPIPVHGAPIIRGGVMIRHNSPAASSNYPTKNKPGQQPSISITPLPRQPQPAQAVQNVQASKGSFVICEICDGYIKDLEQLRNHMQWIHKVKIHPKMIYNRPPLNCQKCQFRFFTDQGLERHLLGSHGLVTSSMQEAANKGKDAGRCPVCGRVYQWKLLNHVARDHNLTLKPAHLSYKCTVCTATFGMYKLFENHVYSAHSVVAKRVMDKNKNNTPSAKASANNDSLLKPLKINDEITIIPQPVKASAANCAKDK

Summary

Uniprot
Interpro
IPR013087   Znf_C2H2_type       
ProteinModelPortal

Ontologies

Topology

Length:
1035
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00391
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1035
 
 

Population Genetic Test Statistics

Pi
0.278944
Theta
3.609361
Tajima's D
-2.280116
CLR
2.438536
CSRT
0.0023998800059997
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号