SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00292
Pre Gene Modal
BGIBMGA011396
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.111
 

Sequence

CDS
ATGTTGATAGAGAAAAGGAAAAGACTAAAAGAACAAGGCATTGTAAACAATAGTCAAAGGGAGCGCTACAATCAATTGCATGCAGAGATTCAAAGGTCTACTCGGAGAGACAGAGATGAGCACATCAATAATATGTGTGAAGAAATTGAGGGACATGCTGATAAAGTGCAGACTAAGGACCTTTTCCTGAAAGTGAAGCAGCTAACGGGTGTCTTCAAGCCGAAGAAATGGATTATCGAAGATAGTAGAGGTAACACCTTGACAGAAATGGAACATGTTTTGGAGAGGTGGAGAAACTACTGTTATGACCTATATCGCGATGAAGATAATTTATGCACCGCCAAAATATGGGATGACCACCTGGAAGAGCCTCCTATACTACTTTCTGAGGTTGAATATGCAATACAAAAACTTAAGCATAAGGTGTTCATTGTCAAGCACAAAGAAAATTTAGATCTAAAATATTTCGATCTGGAGCACTCGCCTTCCAGTCACGAGTACCATAACTTGTCTTCGTTTTCCAAGACGCTGTACGAACAGAGCGGTTAA
Protein
MLIEKRKRLKEQGIVNNSQRERYNQLHAEIQRSTRRDRDEHINNMCEEIEGHADKVQTKDLFLKVKQLTGVFKPKKWIIEDSRGNTLTEMEHVLERWRNYCYDLYRDEDNLCTAKIWDDHLEEPPILLSEVEYAIQKLKHKVFIVKHKENLDLKYFDLEHSPSSHEYHNLSSFSKTLYEQSG

Summary

EMBL
GU815090    ADF18553.1    BABH01034706    FJ265548    ADI61816.1    KZ150025    + More
PZC74827.1    LBMM01007694    KMQ89503.1    KZ150203    PZC72267.1    FJ265559    ADI61827.1    ODYU01006118    SOQ47682.1    DPCO01000033    HCE59365.1    FJ265557    ADI61825.1    FJ265553    ADI61821.1    FJ265552    ADI61820.1    FJ265547    ADI61815.1    JTDY01003909    KOB68843.1    FJ265560    ADI61828.1    LBMM01000801    KMQ97461.1    MRZV01001667    PIK36482.1    JTDY01001360    KOB74082.1    LBMM01011957    KMQ86519.1    KN538403    KHJ42451.1    KL367526    KFD66335.1    AMGL01013224    AMGL01013225    GBBM01006247    JAC29171.1    GBBM01003639    JAC31779.1    BDSA01000081    GBE63537.1    AFYH01196306    NEVH01025141    PNF15737.1    NEVH01024527    PNF17035.1    AAGJ04118689    AAGJ04161747    NEVH01022660    PNF18262.1    NEVH01022635    PNF18667.1    AFYH01136302    NEVH01000276    PNF43685.1    NEVH01023953    PNF17910.1    ABLF02040179    GGMS01012699    MBY81902.1    NEVH01005277    PNF39130.1    NEVH01006736    PNF36722.1    NEVH01003750    PNF40086.1    NEVH01014840    PNF27481.1    NEVH01018380    PNF23492.1    NEVH01017533    PNF24153.1    NEVH01015421    PNF26777.1    NEVH01002982    PNF41147.1    NEVH01021610    PNF19569.1    NEVH01007824    PNF35184.1    NEVH01021921    PNF19468.1    NEVH01011914    PNF31128.1    PZQS01000008    PVD25402.1    NEVH01021928    PNF19298.1    NEVH01017452    PNF24293.1    NEVH01021931    PNF19256.1    NEVH01015305    PNF27148.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00043   GST_C
PF03372   Exo_endo_phos
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR027124   Swc5/CFDP2       
IPR002138   Pept_C14_p10       
IPR036282   Glutathione-S-Trfase_C_sf       
IPR010987   Glutathione-S-Trfase_C-like       
IPR004046   GST_C       
SUPFAM
SSF56219   SSF56219        + More
SSF47616   SSF47616       
Gene 3D

Ontologies

Topology

Length:
182
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.28396
outside
1  -  182
 
 

Population Genetic Test Statistics

Pi
0.260318
Theta
1.477877
Tajima's D
-1.567355
CLR
2.769384
CSRT
0.0395480225988701
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号