SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00285
Annotation
retroelement_polyprotein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 4.167
 

Sequence

CDS
ATGGAGAAATTAAGATTTGATTTTGCAATGAAATCAATGGCGGATGGAAAAACAAACGTCATATGCATAACTTCCATTGCTACACCAAGTGGACAAGTTTTTGGAATTCCAGTCGAATATCAACCCGTAAATCTTCATAAGGTGATCACAACTACTCCTAACTACACTAGAGTAAAAAACTCTTTAGTAAAAACGCATCAAACGAGGAAAACATGGATAACTGTGACGGAGGAAATTTCAAAAACATATTTGGATGAAGAACAAAATTTGCAATTCAATGATTGTTATTTGGAAGAGATTTCAGAACAACCTGTTAGTTATGAATCGACATCTAGTGATTCTAATCACATGCTTGAAAAACTGTTAGAAAAACTACAAGAACAAAAACAGCAGAAACCAGAAAAACAAAATTTAGGGAAAATTGCAAAGGATTTTATTATAGAAAAATTCAACGGCCGTAATTCAAATGCATTACAGTGGATCAAAGATTTTAATAAAGAATGTGAACGTTTTCAAATAAACGAGGATAAACAAAAAATTGAAATTTTGAAGAACTTCTTAGAAAATGCTAGTGTAGATTGGTACAGTTGTATGCTGATGAAGCTTACAGTACAATCAGAATGGAGCAAATGGGAGAAAAAATTTTGTGAGACATTTGCGAACAAAGGATGGTCCTCCACTAGATATGCTCTTGCCTTTAAATATCAATCGGGATCCTTACTTGAGTATGCTTTAAAGAAGGAGAAATTATTGTTGGAAGTCAGGAAGACAGTGGATACCGGAACAATTATTGATCTCATAGCATTTGGTTTACCCAATTATGTGGCGGACAAGATTGACAAAGAAACATTACAAAGAACGGAAGACCTTTACAATGAGATAAGAAAATTGGAACATCTGGTGATGAAAAATAAATATGAAAAAAGGAACAGCTCATATAATTTAGATAATAAAGGGAAAAATATTGACGAAAAGAAACCATGCCCAATCTGTTTAAATGAGAAAAAAGGGAAACGGTTCCACCCAGAAGACAGCTGTTGGTTCAAAGAAAAAAATAAAAAAGCTGTGGTTTCTGGAATCTATGACTCTGGATCTAATGTTTCTTTAATTAATGCAAGATTATTGAAAATACAAGAGAAACAGAAGACAAATGATATGCAAGTTGTAAACTTAAAAACTATTAATGGTGAGAAAAAAACGAAAGGTATGGTAACGCTAAAAATAAAAATCTACAATATTGAAAGAAATATGGATATTTTTGTGGTGGATAATGAAAATTTTAACTATGACTTCTTAATTGGTTTGGATTGTATAAAAAAATTCAAATTAATACAAAATGAAGAACTTAACATCATACAATATCCCGAAAAGAAAAGCATAATCTCAAATGAACATTGTTTTAATGAGAATAATTTAACAAATGTCGGAATTCCTGATGTACTAGGTGACAAAAATAAAGAACAAACATTTAAAAAGAGAATAGAAGAGAAAGAGAAGATAGAGATGGAACTATACTCTGAGATAGTAAAAAAGGGTACTACTATAAATACCAACAAATTGTGTGAAATTAATTTCAATGAACATGTACACATTGATGAATTTCAAATGTCTGTAAATCATCTAGATTTATATCAGCAATCAAAAATTGAGAAGTTAGTAGATAAATACAAATCTGTTTTTGCTAAGGACAAATATGATGTTGGCTCTGTGCAGGATTATGAAGCCCATATAGACTTGATGGTAGATAAATACTGCTATAAGCGTCCGTACAGATGCACAATTGAAGACAGAACAGAAATTGAAAGTCAAATATCGAAGCTACTACAGAAAAATTTGATAGAGGAATCTTACAGCCCGTTTGCTGCTCCTGTAACTCTAGCATATAAGAAAGAAGATGATAAAAAAACAAGATTATGCATAGATTTCAGAGATTTAAACAAAATAGTAGTTCCACAATCACAACCTTTCCCACTTATAGAGGACTTAATGACCAAAACAGTAAACTGTAAGTATTATTCTACATTAGACATAAACTCAGCATTTTGGTCGATCCCATTGAAAATTCAAGATAGACATAAGACTGCTTTTGTGACACAAGAAGGACATTTTCAATGGACTTGTCTCCCATTTGGGTTAAAGACTGCACCAGCAATTTTCCAAAGAATATTGAGCAATATTATAAGAAAACACAGACTATCTAACTTTGCAGTAAACTTTATTGACGACATCTTAATTTTTTCTAAAACTTTTGAGGAACATATACAACACATATCGAGACTACTGGAAGCAATACAAAAGGAAGGGTTTAGACTGAAGTTTTCAAAATGTACATTTGCAAGTCACCATGCTAAATACTTGGGTCATATAATAGAAAACAATTCAGTTAGACCTCTGAAAGATTATTTAACTGCTGTCAAAAGCTTCCCAATTCCAGAAACAAGGAAAAATATACGGCAGTTTTTGGGAAAAGTAAATTTTCATCATAAGTTTGTACCACATAGTGCAATTATCCTCGATCCATTACATAACTTATTAAGAAAAGATGTGAAATTTGTATGGACGGCAGAATGCCAGGAAGCATTTGATAAAATTAGAGCATTGCTTTGCTCAGAACCAATCCTAAAAATATTTGACCCAGATTCACCGATAAGAATTTACACAGATGCTAGTATCAAAGGAGTTGGAGCAGTGTTGAAACAAGACGATGAAAACGGCGTGAGTAAACCGGTTGCTTATTTTTCGAAGAAATTAACAGAAGCACAGAAAAAGAAGAAGGCAATATACTTAGAATGTCTGGCGATAAAAGAAGCAGTCAAATACTGGCAACATTGGCTTATGGGAAAAGAATTTATGGTATACACAGATCATAAACCCCTGGAAAATATGAACATTAAAGCTCGAACTGATGAGGAACTAGCCAAAAATATTACAGCAAACATTAATAAAATGTGTGATGCGTGTGAAACCTGCATTAAAAACAAGTCCAGGAGGAAGTCGAAATATGGTTTAATGTCACATTTGGGACCAGCCACACACCCGTTTGAAATTGTATCCATCGATACTATTGGGGGCTTTGGAGGATCCCGATCAACCAAAAGAGAAGGGTATAAATTGGAAGAAGGAGATAGTGTTTATGTGGAGAATGGAAATAAATTAAACAGGAAAAAAATGGATGAATTGAGAACAGGGCCATACAAAATACTAAAGAAGATTTCAGAATCGATCTATGAAGTTGACACCGGACACAAAAAAGCAGAATCAAACCTCTACCATATAACAAAGTTGTCTCCAGTGTCTATCTGA
Protein
MEKLRFDFAMKSMADGKTNVICITSIATPSGQVFGIPVEYQPVNLHKVITTTPNYTRVKNSLVKTHQTRKTWITVTEEISKTYLDEEQNLQFNDCYLEEISEQPVSYESTSSDSNHMLEKLLEKLQEQKQQKPEKQNLGKIAKDFIIEKFNGRNSNALQWIKDFNKECERFQINEDKQKIEILKNFLENASVDWYSCMLMKLTVQSEWSKWEKKFCETFANKGWSSTRYALAFKYQSGSLLEYALKKEKLLLEVRKTVDTGTIIDLIAFGLPNYVADKIDKETLQRTEDLYNEIRKLEHLVMKNKYEKRNSSYNLDNKGKNIDEKKPCPICLNEKKGKRFHPEDSCWFKEKNKKAVVSGIYDSGSNVSLINARLLKIQEKQKTNDMQVVNLKTINGEKKTKGMVTLKIKIYNIERNMDIFVVDNENFNYDFLIGLDCIKKFKLIQNEELNIIQYPEKKSIISNEHCFNENNLTNVGIPDVLGDKNKEQTFKKRIEEKEKIEMELYSEIVKKGTTINTNKLCEINFNEHVHIDEFQMSVNHLDLYQQSKIEKLVDKYKSVFAKDKYDVGSVQDYEAHIDLMVDKYCYKRPYRCTIEDRTEIESQISKLLQKNLIEESYSPFAAPVTLAYKKEDDKKTRLCIDFRDLNKIVVPQSQPFPLIEDLMTKTVNCKYYSTLDINSAFWSIPLKIQDRHKTAFVTQEGHFQWTCLPFGLKTAPAIFQRILSNIIRKHRLSNFAVNFIDDILIFSKTFEEHIQHISRLLEAIQKEGFRLKFSKCTFASHHAKYLGHIIENNSVRPLKDYLTAVKSFPIPETRKNIRQFLGKVNFHHKFVPHSAIILDPLHNLLRKDVKFVWTAECQEAFDKIRALLCSEPILKIFDPDSPIRIYTDASIKGVGAVLKQDDENGVSKPVAYFSKKLTEAQKKKKAIYLECLAIKEAVKYWQHWLMGKEFMVYTDHKPLENMNIKARTDEELAKNITANINKMCDACETCIKNKSRRKSKYGLMSHLGPATHPFEIVSIDTIGGFGGSRSTKREGYKLEEGDSVYVENGNKLNRKKMDELRTGPYKILKKISESIYEVDTGHKKAESNLYHITKLSPVSI

Summary

Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF00078   RVT_1
Interpro
IPR041577   RT_RNaseH_2        + More
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR012337   RNaseH-like_sf       
IPR036397   RNaseH_sf       
SUPFAM
SSF53098   SSF53098       
Gene 3D
PDB
4OL8     E-value=2.10379e-67,     Score=654

Ontologies

Topology

Length:
1100
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.260270000000001
Exp number, first 60 AAs:
0.25168
Total prob of N-in:
0.01254
outside
1  -  1100
 
 

Population Genetic Test Statistics

Pi
3.206038
Theta
4.945794
Tajima's D
-1.597996
CLR
15.538824
CSRT
0.0433978301084946
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号